Incidental Mutation 'R3974:Smad4'
ID312560
Institutional Source Beutler Lab
Gene Symbol Smad4
Ensembl Gene ENSMUSG00000024515
Gene NameSMAD family member 4
SynonymsDpc4, Smad 4, Madh4, DPC4, D18Wsu70e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3974 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location73639009-73703780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73677736 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 59 (T59K)
Ref Sequence ENSEMBL: ENSMUSP00000110589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025393] [ENSMUST00000114939]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025393
AA Change: T59K

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025393
Gene: ENSMUSG00000024515
AA Change: T59K

DomainStartEndE-ValueType
DWA 31 140 5.77e-65 SMART
low complexity region 286 299 N/A INTRINSIC
DWB 320 529 1.41e-123 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114939
AA Change: T59K

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110589
Gene: ENSMUSG00000024515
AA Change: T59K

DomainStartEndE-ValueType
DWA 31 140 5.77e-65 SMART
low complexity region 286 299 N/A INTRINSIC
DWB 320 529 1.41e-123 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129326
Meta Mutation Damage Score 0.414 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to TGF-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired formation of extraembryonic membrane and endoderm and die prior to gastrulation. Heterozygotes develop polyposis of the glandular stomach and duodenum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
Abca8a A T 11: 110,083,502 M202K probably damaging Het
Abhd4 T A 14: 54,262,960 I117N probably damaging Het
Adam23 T A 1: 63,547,729 Y416* probably null Het
Cenpe A G 3: 135,235,225 probably null Het
Cenph A G 13: 100,763,567 V151A probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Cnbd1 G A 4: 18,887,693 R274C probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Dll4 A G 2: 119,334,092 D664G probably damaging Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Far2 T A 6: 148,150,754 I177N probably damaging Het
Flt4 T G 11: 49,636,740 V910G probably damaging Het
Fmod A G 1: 134,040,758 R179G probably benign Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm884 A T 11: 103,619,101 probably benign Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Grik2 A T 10: 49,422,654 Y37N probably damaging Het
Grn T C 11: 102,436,339 V559A probably damaging Het
Muc2 T A 7: 141,746,804 probably benign Het
Myo5b T C 18: 74,634,481 Y287H probably damaging Het
Nbeal2 T C 9: 110,633,846 T1350A probably damaging Het
Nfkbiz T C 16: 55,818,436 I220M probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1049 A T 2: 86,255,591 I34N possibly damaging Het
Olfr598 T G 7: 103,329,078 D197E probably damaging Het
Omg T A 11: 79,502,398 E211D probably benign Het
Pcdhb4 A G 18: 37,308,848 T404A possibly damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Ptprq T G 10: 107,712,062 K158N possibly damaging Het
Rimbp2 A G 5: 128,797,798 V243A probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rtn4 C T 11: 29,707,505 T553I probably damaging Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1f C A 12: 103,693,571 G151* probably null Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slco1a1 A T 6: 141,909,093 S611T probably benign Het
Syne1 T C 10: 5,043,630 D8370G probably benign Het
Tigd4 G A 3: 84,595,278 A501T possibly damaging Het
Tjp1 A T 7: 65,297,639 C1724* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tyw5 A T 1: 57,391,528 D165E probably damaging Het
U2af2 T A 7: 5,069,439 probably null Het
Ube3b T A 5: 114,412,430 D839E probably benign Het
Ush2a A G 1: 188,381,501 D639G probably benign Het
Veph1 A T 3: 66,158,227 M473K probably benign Het
Vmn2r72 A T 7: 85,749,809 N445K probably damaging Het
Vps37d T C 5: 135,076,539 M77V probably null Het
Other mutations in Smad4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Smad4 APN 18 73675809 missense probably damaging 1.00
IGL01647:Smad4 APN 18 73640473 splice site probably benign
IGL02055:Smad4 APN 18 73641928 splice site probably benign
IGL02101:Smad4 APN 18 73658652 missense probably benign 0.02
IGL02306:Smad4 APN 18 73662869 critical splice acceptor site probably null
R0391:Smad4 UTSW 18 73658649 missense probably benign
R1118:Smad4 UTSW 18 73640262 missense probably benign 0.41
R1163:Smad4 UTSW 18 73648907 missense probably damaging 0.99
R1211:Smad4 UTSW 18 73649911 critical splice acceptor site probably null
R1616:Smad4 UTSW 18 73640262 missense probably benign 0.41
R1742:Smad4 UTSW 18 73675897 missense probably damaging 1.00
R1829:Smad4 UTSW 18 73641894 missense probably benign 0.20
R2045:Smad4 UTSW 18 73649806 nonsense probably null
R2126:Smad4 UTSW 18 73662744 missense probably benign 0.02
R3013:Smad4 UTSW 18 73648904 missense probably damaging 1.00
R3973:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R3975:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R4879:Smad4 UTSW 18 73641903 missense probably damaging 1.00
R5101:Smad4 UTSW 18 73675860 missense probably benign 0.41
R5597:Smad4 UTSW 18 73662827 missense probably benign
R5984:Smad4 UTSW 18 73677911 start codon destroyed probably benign 0.29
R6450:Smad4 UTSW 18 73677746 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ATCTGGGAATGCTCTCTTCTCG -3'
(R):5'- GGCCATTGGTTTTCACTGCC -3'

Sequencing Primer
(F):5'- GCCTCTTTCAGTATCTGTACACAC -3'
(R):5'- GGTTTTCACTGCCTTCAAAAGATC -3'
Posted On2015-04-30