Incidental Mutation 'R3975:Copa'
ID312567
Institutional Source Beutler Lab
Gene Symbol Copa
Ensembl Gene ENSMUSG00000026553
Gene Namecoatomer protein complex subunit alpha
Synonymsxenin
MMRRC Submission 040939-MU
Accession Numbers

Genbank: NM_009938; MGI: 1334462

Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R3975 (G1)
Quality Score216
Status Not validated
Chromosome1
Chromosomal Location172082529-172122330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 172121245 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1155 (S1155T)
Ref Sequence ENSEMBL: ENSMUSP00000027833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027833] [ENSMUST00000135192]
Predicted Effect probably benign
Transcript: ENSMUST00000027833
AA Change: S1155T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553
AA Change: S1155T

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 776 5.4e-144 PFAM
Pfam:COPI_C 824 1233 1.4e-190 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122845
Predicted Effect probably benign
Transcript: ENSMUST00000135192
AA Change: S1146T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553
AA Change: S1146T

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 767 1.1e-148 PFAM
Pfam:COPI_C 815 1224 3.6e-216 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142765
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(6) : Gene trapped(6)

 

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bfsp2 A G 9: 103,480,072 V52A probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Ceacam16 C A 7: 19,853,612 Q410H probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1090 T A 2: 86,754,543 H65L probably damaging Het
Olfr134 A G 17: 38,175,495 N137S probably benign Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Olfr693 T C 7: 106,677,785 R234G probably damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Pex5l C A 3: 33,015,015 C111F probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Rps6 A G 4: 86,856,813 V18A probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Smad6 A G 9: 64,020,930 V32A probably benign Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Thrb A G 14: 18,033,456 I406M probably damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wipf1 C T 2: 73,437,169 G295D probably benign Het
Wisp3 C G 10: 39,155,098 C143S probably damaging Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Copa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Copa APN 1 172110688 missense possibly damaging 0.87
IGL01360:Copa APN 1 172087588 unclassified probably null
IGL01434:Copa APN 1 172119561 missense probably benign 0.00
IGL01744:Copa APN 1 172113189 missense probably benign 0.01
IGL01837:Copa APN 1 172118852 missense probably benign 0.01
IGL01988:Copa APN 1 172118264 missense probably benign 0.09
IGL02059:Copa APN 1 172099753 missense probably damaging 0.96
IGL02123:Copa APN 1 172112128 missense probably damaging 1.00
IGL02731:Copa APN 1 172102218 missense possibly damaging 0.77
IGL03114:Copa APN 1 172119268 nonsense probably null
P0027:Copa UTSW 1 172111948 missense possibly damaging 0.87
PIT4434001:Copa UTSW 1 172106175 missense probably benign 0.00
R0233:Copa UTSW 1 172087667 critical splice donor site probably null
R0465:Copa UTSW 1 172118305 missense probably damaging 1.00
R0547:Copa UTSW 1 172121687 splice site probably benign
R0568:Copa UTSW 1 172112137 missense possibly damaging 0.91
R0628:Copa UTSW 1 172091025 splice site probably benign
R1328:Copa UTSW 1 172121691 splice site probably benign
R1494:Copa UTSW 1 172104127 missense probably benign 0.27
R1728:Copa UTSW 1 172111987 missense probably benign
R1758:Copa UTSW 1 172104144 missense probably damaging 1.00
R1784:Copa UTSW 1 172111987 missense probably benign
R1942:Copa UTSW 1 172111888 missense probably damaging 1.00
R2054:Copa UTSW 1 172118957 nonsense probably null
R2299:Copa UTSW 1 172121725 missense probably benign 0.10
R2518:Copa UTSW 1 172119901 missense probably benign
R2680:Copa UTSW 1 172121404 nonsense probably null
R3080:Copa UTSW 1 172113149 missense probably damaging 1.00
R3160:Copa UTSW 1 172091233 missense probably damaging 1.00
R3161:Copa UTSW 1 172091233 missense probably damaging 1.00
R3162:Copa UTSW 1 172091233 missense probably damaging 1.00
R3162:Copa UTSW 1 172091233 missense probably damaging 1.00
R3973:Copa UTSW 1 172121245 missense probably benign 0.00
R4031:Copa UTSW 1 172108375 missense probably damaging 1.00
R4155:Copa UTSW 1 172101425 missense probably damaging 1.00
R4227:Copa UTSW 1 172118115 intron probably benign
R4244:Copa UTSW 1 172110718 missense probably benign 0.00
R4254:Copa UTSW 1 172102244 missense probably damaging 1.00
R4291:Copa UTSW 1 172092397 intron probably benign
R4323:Copa UTSW 1 172119264 missense probably damaging 1.00
R4402:Copa UTSW 1 172102224 missense probably damaging 1.00
R4711:Copa UTSW 1 172119988 missense probably damaging 1.00
R4721:Copa UTSW 1 172104274 splice site probably benign
R4773:Copa UTSW 1 172105220 missense probably damaging 1.00
R4794:Copa UTSW 1 172119321 missense probably damaging 1.00
R4887:Copa UTSW 1 172092276 missense probably benign 0.39
R4953:Copa UTSW 1 172082886 unclassified probably benign
R5139:Copa UTSW 1 172121329 missense probably damaging 0.99
R5152:Copa UTSW 1 172118061 missense probably benign 0.34
R5297:Copa UTSW 1 172113108 missense probably damaging 1.00
R5586:Copa UTSW 1 172105222 missense probably damaging 1.00
R5698:Copa UTSW 1 172118944 nonsense probably null
R6283:Copa UTSW 1 172118848 missense possibly damaging 0.79
R6921:Copa UTSW 1 172111924 missense possibly damaging 0.63
R6934:Copa UTSW 1 172110686 missense possibly damaging 0.64
R7009:Copa UTSW 1 172091000 missense probably damaging 0.96
R7194:Copa UTSW 1 172119944 missense probably damaging 0.99
T0722:Copa UTSW 1 172111948 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACTTGCGTTGTCATGTCCTG -3'
(R):5'- GCAGATTTGCCCCTTGAAC -3'

Sequencing Primer
(F):5'- CAGGCTGTCCTAGAACTTGAGATC -3'
(R):5'- AGATTTGCCCCTTGAACTCAGGG -3'
Posted On2015-04-30