Incidental Mutation 'R3975:Pex5l'
ID312574
Institutional Source Beutler Lab
Gene Symbol Pex5l
Ensembl Gene ENSMUSG00000027674
Gene Nameperoxisomal biogenesis factor 5-like
SynonymsPex2, PXR2, TRIP8b, 1700016J08Rik
MMRRC Submission 040939-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R3975 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location32949408-33143247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 33015015 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 111 (C111F)
Ref Sequence ENSEMBL: ENSMUSP00000142196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078226] [ENSMUST00000108224] [ENSMUST00000108225] [ENSMUST00000108226] [ENSMUST00000192093] [ENSMUST00000193289] [ENSMUST00000193681] [ENSMUST00000194016]
Predicted Effect probably damaging
Transcript: ENSMUST00000078226
AA Change: C76F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077353
Gene: ENSMUSG00000027674
AA Change: C76F

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108219
SMART Domains Protein: ENSMUSP00000103854
Gene: ENSMUSG00000027674

DomainStartEndE-ValueType
low complexity region 124 140 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
PDB:4EQF|A 266 362 8e-64 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000108224
AA Change: C51F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103859
Gene: ENSMUSG00000027674
AA Change: C51F

DomainStartEndE-ValueType
low complexity region 88 104 N/A INTRINSIC
low complexity region 190 204 N/A INTRINSIC
TPR 325 358 6.95e-4 SMART
Blast:TPR 359 392 2e-14 BLAST
TPR 439 472 3.19e-3 SMART
TPR 473 506 3.47e-4 SMART
TPR 507 540 1.1e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108225
AA Change: C76F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103860
Gene: ENSMUSG00000027674
AA Change: C76F

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108226
AA Change: C28F

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103861
Gene: ENSMUSG00000027674
AA Change: C28F

DomainStartEndE-ValueType
low complexity region 65 81 N/A INTRINSIC
low complexity region 166 180 N/A INTRINSIC
TPR 301 334 6.95e-4 SMART
Blast:TPR 335 368 2e-14 BLAST
TPR 415 448 3.19e-3 SMART
TPR 449 482 3.47e-4 SMART
TPR 483 516 1.1e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122716
Predicted Effect probably damaging
Transcript: ENSMUST00000192093
AA Change: C76F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141387
Gene: ENSMUSG00000027674
AA Change: C76F

DomainStartEndE-ValueType
low complexity region 113 129 N/A INTRINSIC
low complexity region 214 228 N/A INTRINSIC
TPR 349 382 6.95e-4 SMART
Blast:TPR 383 416 4e-14 BLAST
TPR 463 496 3.19e-3 SMART
TPR 497 530 3.47e-4 SMART
TPR 531 564 1.1e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193289
AA Change: C111F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142008
Gene: ENSMUSG00000027674
AA Change: C111F

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193681
AA Change: C111F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141454
Gene: ENSMUSG00000027674
AA Change: C111F

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194016
AA Change: C111F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142196
Gene: ENSMUSG00000027674
AA Change: C111F

DomainStartEndE-ValueType
low complexity region 148 164 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
TPR 384 417 6.95e-4 SMART
Blast:TPR 418 451 4e-14 BLAST
TPR 498 531 3.19e-3 SMART
TPR 532 565 3.47e-4 SMART
TPR 566 599 1.1e-1 SMART
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation lacking isoform b exhibit exhibit reduced hyperpolarization-activated current in CA1 pyramidal neuron, impaired motor learning, impaired nest-building, decreased startle reflex, and decreased depression-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bfsp2 A G 9: 103,480,072 V52A probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Ceacam16 C A 7: 19,853,612 Q410H probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1090 T A 2: 86,754,543 H65L probably damaging Het
Olfr134 A G 17: 38,175,495 N137S probably benign Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Olfr693 T C 7: 106,677,785 R234G probably damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Rps6 A G 4: 86,856,813 V18A probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Smad6 A G 9: 64,020,930 V32A probably benign Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Thrb A G 14: 18,033,456 I406M probably damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wipf1 C T 2: 73,437,169 G295D probably benign Het
Wisp3 C G 10: 39,155,098 C143S probably damaging Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Pex5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Pex5l APN 3 32952597 missense probably damaging 1.00
IGL01621:Pex5l APN 3 33014961 splice site probably null
IGL01813:Pex5l APN 3 33082055 missense probably benign 0.02
IGL02313:Pex5l APN 3 32992992 missense probably benign 0.22
IGL02508:Pex5l APN 3 32992902 splice site probably benign
IGL02997:Pex5l APN 3 32955842 splice site probably benign
R0195:Pex5l UTSW 3 32992953 missense possibly damaging 0.87
R0674:Pex5l UTSW 3 32952616 missense probably damaging 1.00
R0729:Pex5l UTSW 3 32954536 splice site probably benign
R1500:Pex5l UTSW 3 33014980 missense probably damaging 1.00
R1513:Pex5l UTSW 3 33015013 nonsense probably null
R1695:Pex5l UTSW 3 32954382 missense probably benign 0.28
R1850:Pex5l UTSW 3 32950876 splice site probably null
R2165:Pex5l UTSW 3 32953132 synonymous probably null
R2679:Pex5l UTSW 3 33082052 missense probably benign 0.02
R2880:Pex5l UTSW 3 32993003 critical splice acceptor site probably null
R2881:Pex5l UTSW 3 32993003 critical splice acceptor site probably null
R3766:Pex5l UTSW 3 33007178 missense probably benign 0.01
R3780:Pex5l UTSW 3 32950844 missense probably damaging 1.00
R3934:Pex5l UTSW 3 33007172 missense probably damaging 1.00
R4285:Pex5l UTSW 3 33007187 missense probably damaging 1.00
R4825:Pex5l UTSW 3 32992985 missense probably damaging 0.99
R4855:Pex5l UTSW 3 33142840 splice site probably benign
R4868:Pex5l UTSW 3 32952490 missense probably damaging 1.00
R5135:Pex5l UTSW 3 32955831 missense probably damaging 1.00
R5217:Pex5l UTSW 3 33007328 splice site probably null
R5223:Pex5l UTSW 3 32958796 missense probably damaging 1.00
R5362:Pex5l UTSW 3 32992916 missense probably damaging 1.00
R5398:Pex5l UTSW 3 32952490 missense probably damaging 1.00
R5829:Pex5l UTSW 3 33005990 missense probably benign 0.00
R6731:Pex5l UTSW 3 32958798 missense probably damaging 1.00
R7180:Pex5l UTSW 3 33024691 splice site probably null
R7452:Pex5l UTSW 3 33004318 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTGGTTACAGACACTATCCCC -3'
(R):5'- CAGTGCTGAAGGCTCATTCC -3'

Sequencing Primer
(F):5'- AACCTGAGTTCAATTGCTGCGAC -3'
(R):5'- AAGGCTCATTCCTTCCCCATGG -3'
Posted On2015-04-30