Mutagenetix > Incidental Mutation

Incidental Mutation 'R3975:Otof'

312591

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

040939-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R3975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30524406-30619276 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30528056 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1929 (L1929P)

Ref Sequence

ENSEMBL: ENSMUSP00000110395 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000101448] [ENSMUST00000114747]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000074171
AA Change: L1934P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: L1934P

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000101448

SMART Domains

Protein: ENSMUSP00000098992
Gene: ENSMUSG00000073102

Domain	Start	End	E-Value	Type
low complexity region	33	55	N/A	INTRINSIC
low complexity region	62	79	N/A	INTRINSIC
Pfam:NYD-SP28	100	200	1.7e-33	PFAM
coiled coil region	280	318	N/A	INTRINSIC
low complexity region	455	473	N/A	INTRINSIC
low complexity region	559	569	N/A	INTRINSIC
low complexity region	599	612	N/A	INTRINSIC
Pfam:NYD-SP28_assoc	673	732	2.2e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114747
AA Change: L1929P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: L1929P

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144125

SMART Domains

Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150734

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200001

Meta Mutation Damage Score

0.5252

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.6%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	T	A	1: 63,586,888 (GRCm39)	Y416*	probably null	Het
Akr1b10	G	T	6: 34,369,431 (GRCm39)		probably null	Het
Arap2	G	T	5: 62,906,237 (GRCm39)	P261T	possibly damaging	Het
Bckdha	C	A	7: 25,330,858 (GRCm39)	D53Y	probably damaging	Het
Bfsp2	A	G	9: 103,357,271 (GRCm39)	V52A	probably benign	Het
Bola3	T	C	6: 83,328,249 (GRCm39)	L45P	probably benign	Het
Cacna2d4	A	G	6: 119,255,134 (GRCm39)		probably null	Het
Ccn6	C	G	10: 39,031,094 (GRCm39)	C143S	probably damaging	Het
Ceacam16	C	A	7: 19,587,537 (GRCm39)	Q410H	probably damaging	Het
Cenpe	A	G	3: 134,940,986 (GRCm39)		probably null	Het
Cenpe	T	C	3: 134,944,233 (GRCm39)		probably null	Het
Clca3a1	A	T	3: 144,738,400 (GRCm39)	V36D	probably damaging	Het
Copa	T	A	1: 171,948,812 (GRCm39)	S1155T	probably benign	Het
Crb2	C	A	2: 37,683,680 (GRCm39)	P1061T	possibly damaging	Het
Crot	T	C	5: 9,027,541 (GRCm39)	T264A	probably benign	Het
Cyp51	C	T	5: 4,141,877 (GRCm39)	G346S	probably damaging	Het
Dnah6	A	G	6: 73,098,975 (GRCm39)	S2027P	possibly damaging	Het
Fbh1	T	C	2: 11,772,021 (GRCm39)	H220R	possibly damaging	Het
Gdf2	T	A	14: 33,666,791 (GRCm39)	V171D	probably damaging	Het
Golgb1	T	G	16: 36,738,933 (GRCm39)	V2424G	probably damaging	Het
Gpbp1l1	T	C	4: 116,428,182 (GRCm39)		probably null	Het
Gpx6	C	A	13: 21,501,828 (GRCm39)	S150Y	probably damaging	Het
Greb1l	A	G	18: 10,522,247 (GRCm39)	N672S	possibly damaging	Het
Kcnma1	C	T	14: 24,053,815 (GRCm39)		probably null	Het
Lrba	T	C	3: 86,258,562 (GRCm39)	F1350L	probably damaging	Het
Nat8f4	A	G	6: 85,878,052 (GRCm39)	V157A	possibly damaging	Het
Niban1	T	C	1: 151,525,086 (GRCm39)	Y164H	probably damaging	Het
Nt5dc2	T	C	14: 30,860,832 (GRCm39)	S439P	probably damaging	Het
Or2ag12	T	C	7: 106,276,992 (GRCm39)	R234G	probably damaging	Het
Or2n1	A	G	17: 38,486,386 (GRCm39)	N137S	probably benign	Het
Or5t18	G	A	2: 86,636,804 (GRCm39)	P180S	possibly damaging	Het
Or8k40	T	A	2: 86,584,887 (GRCm39)	H65L	probably damaging	Het
Orm3	A	T	4: 63,274,395 (GRCm39)		probably null	Het
Pex5l	C	A	3: 33,069,164 (GRCm39)	C111F	probably damaging	Het
Plcl1	T	A	1: 55,737,374 (GRCm39)	M905K	probably benign	Het
Prdm6	T	C	18: 53,673,278 (GRCm39)	I186T	possibly damaging	Het
Rara	T	G	11: 98,861,395 (GRCm39)	I236S	probably damaging	Het
Reln	A	T	5: 22,200,364 (GRCm39)	S1379T	possibly damaging	Het
Rnps1-ps	A	T	6: 7,983,149 (GRCm39)		noncoding transcript	Het
Rp1l1	T	A	14: 64,267,758 (GRCm39)	Y1115N	probably damaging	Het
Rpe65	A	T	3: 159,310,222 (GRCm39)	N135I	probably damaging	Het
Rps6	A	G	4: 86,775,050 (GRCm39)	V18A	probably benign	Het
Scrn3	T	C	2: 73,166,121 (GRCm39)	S385P	possibly damaging	Het
Sis	T	C	3: 72,850,968 (GRCm39)	T577A	probably damaging	Het
Slx1b	G	A	7: 126,290,979 (GRCm39)	L239F	probably damaging	Het
Smad4	G	T	18: 73,810,807 (GRCm39)	T59K	possibly damaging	Het
Smad6	A	G	9: 63,928,212 (GRCm39)	V32A	probably benign	Het
Smc6	T	A	12: 11,324,075 (GRCm39)	F73L	probably damaging	Het
Sorbs2	T	C	8: 46,225,747 (GRCm39)		probably null	Het
Svbp	T	A	4: 119,053,090 (GRCm39)	F32I	probably benign	Het
Tap1	C	A	17: 34,408,541 (GRCm39)		probably benign	Het
Tesk1	C	T	4: 43,445,786 (GRCm39)	P280S	possibly damaging	Het
Thrb	A	G	14: 18,033,456 (GRCm38)	I406M	probably damaging	Het
Tsc22d1	T	C	14: 76,656,049 (GRCm39)	S761P	probably damaging	Het
Ttn	T	C	2: 76,706,997 (GRCm39)		probably benign	Het
Umodl1	C	A	17: 31,203,763 (GRCm39)	Y525*	probably null	Het
Vmn2r70	C	T	7: 85,208,540 (GRCm39)	V646I	probably benign	Het
Wipf1	C	T	2: 73,267,513 (GRCm39)	G295D	probably benign	Het
Zim1	A	T	7: 6,680,129 (GRCm39)	H511Q	probably damaging	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30,533,248 (GRCm39)	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30,532,967 (GRCm39)	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30,556,666 (GRCm39)	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30,543,097 (GRCm39)	critical splice donor site	probably null
IGL01019:Otof	APN	5	30,562,560 (GRCm39)	missense	probably benign	0.01
IGL01025:Otof	APN	5	30,541,597 (GRCm39)	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30,533,617 (GRCm39)	critical splice donor site	probably null
IGL01110:Otof	APN	5	30,619,069 (GRCm39)	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30,538,879 (GRCm39)	missense	probably benign	0.00
IGL01285:Otof	APN	5	30,562,527 (GRCm39)	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30,598,723 (GRCm39)	missense	probably benign	0.00
IGL01337:Otof	APN	5	30,576,856 (GRCm39)	missense	probably benign	0.17
IGL01337:Otof	APN	5	30,563,121 (GRCm39)	missense	possibly damaging	0.93
IGL01834:Otof	APN	5	30,556,564 (GRCm39)	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30,536,598 (GRCm39)	splice site	probably benign
IGL01969:Otof	APN	5	30,539,827 (GRCm39)	splice site	probably benign
IGL02075:Otof	APN	5	30,528,070 (GRCm39)	missense	probably benign	0.23
IGL02077:Otof	APN	5	30,556,579 (GRCm39)	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30,531,336 (GRCm39)	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30,528,128 (GRCm39)	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30,534,026 (GRCm39)	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30,531,426 (GRCm39)	missense	probably benign	0.08
IGL02864:Otof	APN	5	30,543,685 (GRCm39)	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30,562,520 (GRCm39)	splice site	probably null
R0285:Otof	UTSW	5	30,536,877 (GRCm39)	critical splice donor site	probably null
R0421:Otof	UTSW	5	30,528,912 (GRCm39)	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30,529,225 (GRCm39)	splice site	probably benign
R0599:Otof	UTSW	5	30,528,049 (GRCm39)	missense	probably damaging	1.00
R0675:Otof	UTSW	5	30,539,705 (GRCm39)	missense	probably benign	0.01
R0715:Otof	UTSW	5	30,552,041 (GRCm39)	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30,528,087 (GRCm39)	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30,529,256 (GRCm39)	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30,536,039 (GRCm39)	missense	probably benign	0.00
R1469:Otof	UTSW	5	30,537,571 (GRCm39)	missense	probably benign	0.00
R1469:Otof	UTSW	5	30,537,571 (GRCm39)	missense	probably benign	0.00
R1474:Otof	UTSW	5	30,536,876 (GRCm39)	critical splice donor site	probably null
R1524:Otof	UTSW	5	30,536,900 (GRCm39)	missense	probably benign	0.03
R1563:Otof	UTSW	5	30,528,349 (GRCm39)	missense	probably benign	0.00
R1732:Otof	UTSW	5	30,543,815 (GRCm39)	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30,536,054 (GRCm39)	missense	probably benign	0.00
R1845:Otof	UTSW	5	30,529,067 (GRCm39)	nonsense	probably null
R1925:Otof	UTSW	5	30,551,532 (GRCm39)	missense	probably benign	0.37
R1938:Otof	UTSW	5	30,533,713 (GRCm39)	missense	probably benign	0.00
R1968:Otof	UTSW	5	30,545,998 (GRCm39)	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30,578,381 (GRCm39)	missense	probably benign	0.01
R1999:Otof	UTSW	5	30,546,116 (GRCm39)	missense	probably benign	0.19
R2027:Otof	UTSW	5	30,578,358 (GRCm39)	missense	probably benign	0.08
R2138:Otof	UTSW	5	30,619,114 (GRCm39)	missense	probably benign	0.01
R2173:Otof	UTSW	5	30,543,718 (GRCm39)	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30,527,551 (GRCm39)	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30,540,184 (GRCm39)	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30,539,145 (GRCm39)	missense	probably benign	0.03
R3442:Otof	UTSW	5	30,529,033 (GRCm39)	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30,542,610 (GRCm39)	missense	probably benign
R3715:Otof	UTSW	5	30,534,215 (GRCm39)	nonsense	probably null
R3806:Otof	UTSW	5	30,543,843 (GRCm39)	critical splice acceptor site	probably null
R4067:Otof	UTSW	5	30,556,635 (GRCm39)	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30,576,850 (GRCm39)	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30,539,762 (GRCm39)	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30,542,508 (GRCm39)	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30,532,344 (GRCm39)	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30,529,244 (GRCm39)	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30,540,914 (GRCm39)	missense	possibly damaging	0.82
R4648:Otof	UTSW	5	30,540,914 (GRCm39)	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30,578,318 (GRCm39)	critical splice donor site	probably null
R4773:Otof	UTSW	5	30,552,026 (GRCm39)	missense	probably benign	0.05
R4839:Otof	UTSW	5	30,576,748 (GRCm39)	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30,536,005 (GRCm39)	critical splice donor site	probably null
R4961:Otof	UTSW	5	30,540,837 (GRCm39)	intron	probably benign
R4991:Otof	UTSW	5	30,551,525 (GRCm39)	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30,540,238 (GRCm39)	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30,541,783 (GRCm39)	missense	possibly damaging	0.54
R5038:Otof	UTSW	5	30,541,783 (GRCm39)	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30,527,483 (GRCm39)	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30,534,064 (GRCm39)	missense	probably benign	0.01
R5365:Otof	UTSW	5	30,539,144 (GRCm39)	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30,532,323 (GRCm39)	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30,529,244 (GRCm39)	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30,571,888 (GRCm39)	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30,529,279 (GRCm39)	missense	possibly damaging	0.94
R6671:Otof	UTSW	5	30,576,877 (GRCm39)	missense	probably benign
R6701:Otof	UTSW	5	30,528,141 (GRCm39)	nonsense	probably null
R6792:Otof	UTSW	5	30,532,978 (GRCm39)	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30,545,583 (GRCm39)	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30,528,987 (GRCm39)	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30,538,882 (GRCm39)	missense	probably benign	0.32
R7060:Otof	UTSW	5	30,545,700 (GRCm39)	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30,528,912 (GRCm39)	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30,532,964 (GRCm39)	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30,540,878 (GRCm39)	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30,545,614 (GRCm39)	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30,527,614 (GRCm39)	missense	probably benign	0.45
R7397:Otof	UTSW	5	30,533,051 (GRCm39)	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30,542,532 (GRCm39)	missense	probably benign	0.04
R7428:Otof	UTSW	5	30,547,169 (GRCm39)	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30,552,005 (GRCm39)	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30,528,364 (GRCm39)	missense	probably benign	0.00
R7714:Otof	UTSW	5	30,527,597 (GRCm39)	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30,537,954 (GRCm39)	missense	probably benign	0.10
R8032:Otof	UTSW	5	30,619,142 (GRCm39)	start codon destroyed	probably benign	0.07
R8153:Otof	UTSW	5	30,546,079 (GRCm39)	missense	probably damaging	1.00
R8158:Otof	UTSW	5	30,537,538 (GRCm39)	missense	probably benign	0.37
R8159:Otof	UTSW	5	30,537,538 (GRCm39)	missense	probably benign	0.37
R8441:Otof	UTSW	5	30,538,200 (GRCm39)	missense	probably damaging	0.99
R8738:Otof	UTSW	5	30,545,968 (GRCm39)	nonsense	probably null
R8813:Otof	UTSW	5	30,540,242 (GRCm39)	missense	probably benign	0.02
R8835:Otof	UTSW	5	30,528,264 (GRCm39)	missense	probably benign	0.44
R8852:Otof	UTSW	5	30,529,044 (GRCm39)	missense	possibly damaging	0.94
R8869:Otof	UTSW	5	30,578,325 (GRCm39)	missense	probably benign	0.08
R9029:Otof	UTSW	5	30,527,419 (GRCm39)	critical splice donor site	probably null
R9031:Otof	UTSW	5	30,537,532 (GRCm39)	missense	probably benign
R9061:Otof	UTSW	5	30,546,001 (GRCm39)	missense	possibly damaging	0.50
R9100:Otof	UTSW	5	30,539,696 (GRCm39)	missense	possibly damaging	0.80
R9121:Otof	UTSW	5	30,536,462 (GRCm39)	missense	probably benign	0.04
R9188:Otof	UTSW	5	30,534,095 (GRCm39)	missense	probably damaging	1.00
R9218:Otof	UTSW	5	30,542,469 (GRCm39)	missense	probably benign
R9280:Otof	UTSW	5	30,528,894 (GRCm39)	missense	probably damaging	0.98
R9395:Otof	UTSW	5	30,532,976 (GRCm39)	missense	probably damaging	1.00
R9400:Otof	UTSW	5	30,540,863 (GRCm39)	critical splice donor site	probably null
R9407:Otof	UTSW	5	30,538,265 (GRCm39)	missense	probably damaging	1.00
R9616:Otof	UTSW	5	30,539,708 (GRCm39)	missense	possibly damaging	0.95
R9665:Otof	UTSW	5	30,584,895 (GRCm39)	missense	probably benign	0.22
R9748:Otof	UTSW	5	30,540,998 (GRCm39)	missense	probably damaging	1.00
R9783:Otof	UTSW	5	30,536,576 (GRCm39)	missense	probably benign
Z1176:Otof	UTSW	5	30,528,930 (GRCm39)	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30,541,002 (GRCm39)	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30,533,641 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGCTTTCTTTGAAGATGAGC -3'
(R):5'- ACCACTTCCTGCTTGGGATC -3'

Sequencing Primer
(F):5'- TTCAGAGGGAAGAGGTAGCTTC -3'
(R):5'- TCCTGCTTGGGATCCGACC -3'

Posted On

2015-04-30