Incidental Mutation 'R3975:Smad4'
ID312623
Institutional Source Beutler Lab
Gene Symbol Smad4
Ensembl Gene ENSMUSG00000024515
Gene NameSMAD family member 4
SynonymsDpc4, Smad 4, Madh4, DPC4, D18Wsu70e
MMRRC Submission 040939-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3975 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location73639009-73703780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73677736 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 59 (T59K)
Ref Sequence ENSEMBL: ENSMUSP00000110589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025393] [ENSMUST00000114939]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025393
AA Change: T59K

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025393
Gene: ENSMUSG00000024515
AA Change: T59K

DomainStartEndE-ValueType
DWA 31 140 5.77e-65 SMART
low complexity region 286 299 N/A INTRINSIC
DWB 320 529 1.41e-123 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114939
AA Change: T59K

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110589
Gene: ENSMUSG00000024515
AA Change: T59K

DomainStartEndE-ValueType
DWA 31 140 5.77e-65 SMART
low complexity region 286 299 N/A INTRINSIC
DWB 320 529 1.41e-123 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129326
Meta Mutation Damage Score 0.414 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to TGF-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired formation of extraembryonic membrane and endoderm and die prior to gastrulation. Heterozygotes develop polyposis of the glandular stomach and duodenum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bfsp2 A G 9: 103,480,072 V52A probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Ceacam16 C A 7: 19,853,612 Q410H probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1090 T A 2: 86,754,543 H65L probably damaging Het
Olfr134 A G 17: 38,175,495 N137S probably benign Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Olfr693 T C 7: 106,677,785 R234G probably damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Pex5l C A 3: 33,015,015 C111F probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Rps6 A G 4: 86,856,813 V18A probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad6 A G 9: 64,020,930 V32A probably benign Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Thrb A G 14: 18,033,456 I406M probably damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wipf1 C T 2: 73,437,169 G295D probably benign Het
Wisp3 C G 10: 39,155,098 C143S probably damaging Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Smad4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Smad4 APN 18 73675809 missense probably damaging 1.00
IGL01647:Smad4 APN 18 73640473 splice site probably benign
IGL02055:Smad4 APN 18 73641928 splice site probably benign
IGL02101:Smad4 APN 18 73658652 missense probably benign 0.02
IGL02306:Smad4 APN 18 73662869 critical splice acceptor site probably null
R0391:Smad4 UTSW 18 73658649 missense probably benign
R1118:Smad4 UTSW 18 73640262 missense probably benign 0.41
R1163:Smad4 UTSW 18 73648907 missense probably damaging 0.99
R1211:Smad4 UTSW 18 73649911 critical splice acceptor site probably null
R1616:Smad4 UTSW 18 73640262 missense probably benign 0.41
R1742:Smad4 UTSW 18 73675897 missense probably damaging 1.00
R1829:Smad4 UTSW 18 73641894 missense probably benign 0.20
R2045:Smad4 UTSW 18 73649806 nonsense probably null
R2126:Smad4 UTSW 18 73662744 missense probably benign 0.02
R3013:Smad4 UTSW 18 73648904 missense probably damaging 1.00
R3973:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R3974:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R4879:Smad4 UTSW 18 73641903 missense probably damaging 1.00
R5101:Smad4 UTSW 18 73675860 missense probably benign 0.41
R5597:Smad4 UTSW 18 73662827 missense probably benign
R5984:Smad4 UTSW 18 73677911 start codon destroyed probably benign 0.29
R6450:Smad4 UTSW 18 73677746 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGGGAATGCTCTCTTCTCGC -3'
(R):5'- TGGTTTTCACTGCCTTCAAAAG -3'

Sequencing Primer
(F):5'- GCCTCTTTCAGTATCTGTACACAC -3'
(R):5'- TGCCTTCAAAAGATCAAAATTACTCC -3'
Posted On2015-04-30