Incidental Mutation 'R3976:Asb4'
ID312635
Institutional Source Beutler Lab
Gene Symbol Asb4
Ensembl Gene ENSMUSG00000042607
Gene Nameankyrin repeat and SOCS box-containing 4
Synonyms
MMRRC Submission 040842-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R3976 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location5383386-5433022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5390771 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 55 (M55L)
Ref Sequence ENSEMBL: ENSMUSP00000139245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043294] [ENSMUST00000183358]
Predicted Effect probably benign
Transcript: ENSMUST00000043294
AA Change: M55L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040331
Gene: ENSMUSG00000042607
AA Change: M55L

DomainStartEndE-ValueType
ANK 74 103 6.26e-2 SMART
ANK 106 135 4.46e-7 SMART
ANK 139 168 4.86e1 SMART
ANK 174 203 2.43e1 SMART
ANK 207 247 1.17e2 SMART
ANK 251 280 8.86e-2 SMART
SOCS_box 381 420 7.48e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183358
AA Change: M55L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139245
Gene: ENSMUSG00000042607
AA Change: M55L

DomainStartEndE-ValueType
ANK 74 103 6.26e-2 SMART
ANK 106 135 4.46e-7 SMART
ANK 139 168 1.02e3 SMART
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants have been described for this gene but some of the full length sequences are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes impaired placentation, embryonic growth arrest, reduced litter size, and pre-eclampsia like features including hypertension and albuminuria in late-stage pregnant females as well as renal defects including glomerular endotheliosis and mesangial expansion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
Abca9 T C 11: 110,148,789 D466G probably benign Het
Atxn7l1 T C 12: 33,325,955 S10P probably damaging Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Cyb5r3 A G 15: 83,160,129 V180A possibly damaging Het
Dglucy A T 12: 100,841,389 T186S probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Fam90a1a G A 8: 21,961,416 D98N probably damaging Het
Fbxo16 T A 14: 65,287,157 L42Q probably damaging Het
Fbxw16 A G 9: 109,439,629 V231A probably benign Het
Fermt3 G A 19: 7,002,424 A447V possibly damaging Het
Fignl2 A G 15: 101,052,586 L605P unknown Het
Gcsam T G 16: 45,619,829 N78K probably damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm28042 C T 2: 120,036,756 H218Y probably benign Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Herpud2 A G 9: 25,110,438 V304A probably damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrp3 T C 7: 35,204,105 D251G probably benign Het
Mapkbp1 T C 2: 120,021,858 V957A possibly damaging Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1306 C T 2: 111,912,606 G108D possibly damaging Het
Olfr267 A G 4: 58,785,164 L186P probably damaging Het
Opn4 C T 14: 34,597,109 R173H probably benign Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rab18 T A 18: 6,778,529 D53E probably benign Het
Rel A G 11: 23,742,939 S365P probably benign Het
Rhbg C A 3: 88,244,536 G383V probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Runx2 T C 17: 44,610,079 T339A possibly damaging Het
Ryr3 T C 2: 112,675,837 E3455G possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Setd3 T C 12: 108,165,158 K3R possibly damaging Het
Spg7 A G 8: 123,079,448 D299G probably damaging Het
Sptbn5 C T 2: 120,048,261 noncoding transcript Het
Srcap A G 7: 127,549,239 T1859A probably benign Het
Suox A G 10: 128,671,037 V374A probably damaging Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tubal3 C T 13: 3,932,946 S242L probably benign Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Other mutations in Asb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02086:Asb4 APN 6 5398386 missense probably benign 0.00
IGL03015:Asb4 APN 6 5398515 missense possibly damaging 0.75
IGL03280:Asb4 APN 6 5423416 missense probably benign
R1146:Asb4 UTSW 6 5423591 missense probably damaging 0.99
R1146:Asb4 UTSW 6 5423591 missense probably damaging 0.99
R1267:Asb4 UTSW 6 5423747 missense probably damaging 1.00
R1435:Asb4 UTSW 6 5398410 missense probably benign 0.33
R1595:Asb4 UTSW 6 5390692 missense probably damaging 1.00
R1764:Asb4 UTSW 6 5390798 splice site probably null
R2118:Asb4 UTSW 6 5390687 missense probably benign
R4020:Asb4 UTSW 6 5390803 splice site probably benign
R4067:Asb4 UTSW 6 5423651 missense probably damaging 1.00
R4469:Asb4 UTSW 6 5423409 missense probably benign 0.01
R4895:Asb4 UTSW 6 5398266 missense probably damaging 0.98
R5432:Asb4 UTSW 6 5430912 missense probably damaging 1.00
R5444:Asb4 UTSW 6 5431040 missense probably damaging 0.98
R6196:Asb4 UTSW 6 5390699 missense probably benign 0.05
R6276:Asb4 UTSW 6 5431043 missense probably damaging 1.00
R6333:Asb4 UTSW 6 5423597 missense probably damaging 1.00
R6922:Asb4 UTSW 6 5398304 missense possibly damaging 0.87
R7098:Asb4 UTSW 6 5398499 missense probably damaging 1.00
R7196:Asb4 UTSW 6 5423356 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCATTGCTCCGCTTCCACAG -3'
(R):5'- ATTCCAGGCGCAAGAATGGC -3'

Sequencing Primer
(F):5'- ACAGGGCTCCGAGGATG -3'
(R):5'- TGTATGGATCTATGAAAATCACCCCC -3'
Posted On2015-04-30