Incidental Mutation 'R3976:Cacna2d4'
ID312638
Institutional Source Beutler Lab
Gene Symbol Cacna2d4
Ensembl Gene ENSMUSG00000041460
Gene Namecalcium channel, voltage-dependent, alpha 2/delta subunit 4
Synonyms5730412N02Rik
MMRRC Submission 040842-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3976 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location119236526-119352407 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 119278173 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037434] [ENSMUST00000037434] [ENSMUST00000186622]
Predicted Effect probably null
Transcript: ENSMUST00000037434
SMART Domains Protein: ENSMUSP00000044660
Gene: ENSMUSG00000041460

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 7.3e-40 PFAM
VWA 296 481 4.37e-14 SMART
Pfam:Cache_1 494 586 1.1e-24 PFAM
low complexity region 837 849 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1000 1011 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000037434
SMART Domains Protein: ENSMUSP00000044660
Gene: ENSMUSG00000041460

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 7.3e-40 PFAM
VWA 296 481 4.37e-14 SMART
Pfam:Cache_1 494 586 1.1e-24 PFAM
low complexity region 837 849 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1000 1011 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186622
SMART Domains Protein: ENSMUSP00000140197
Gene: ENSMUSG00000041460

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 6.4e-44 PFAM
VWA 296 481 2.7e-16 SMART
Pfam:Cache_1 494 559 1.1e-7 PFAM
low complexity region 812 824 N/A INTRINSIC
low complexity region 950 959 N/A INTRINSIC
low complexity region 975 986 N/A INTRINSIC
low complexity region 1095 1118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190015
Meta Mutation Damage Score 0.612 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit severe loss of retinal signaling associated with abnormal photoreceptor ribbon synapses and cone-rod dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
Abca9 T C 11: 110,148,789 D466G probably benign Het
Asb4 A T 6: 5,390,771 M55L probably benign Het
Atxn7l1 T C 12: 33,325,955 S10P probably damaging Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Cyb5r3 A G 15: 83,160,129 V180A possibly damaging Het
Dglucy A T 12: 100,841,389 T186S probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Fam90a1a G A 8: 21,961,416 D98N probably damaging Het
Fbxo16 T A 14: 65,287,157 L42Q probably damaging Het
Fbxw16 A G 9: 109,439,629 V231A probably benign Het
Fermt3 G A 19: 7,002,424 A447V possibly damaging Het
Fignl2 A G 15: 101,052,586 L605P unknown Het
Gcsam T G 16: 45,619,829 N78K probably damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm28042 C T 2: 120,036,756 H218Y probably benign Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Herpud2 A G 9: 25,110,438 V304A probably damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrp3 T C 7: 35,204,105 D251G probably benign Het
Mapkbp1 T C 2: 120,021,858 V957A possibly damaging Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1306 C T 2: 111,912,606 G108D possibly damaging Het
Olfr267 A G 4: 58,785,164 L186P probably damaging Het
Opn4 C T 14: 34,597,109 R173H probably benign Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rab18 T A 18: 6,778,529 D53E probably benign Het
Rel A G 11: 23,742,939 S365P probably benign Het
Rhbg C A 3: 88,244,536 G383V probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Runx2 T C 17: 44,610,079 T339A possibly damaging Het
Ryr3 T C 2: 112,675,837 E3455G possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Setd3 T C 12: 108,165,158 K3R possibly damaging Het
Spg7 A G 8: 123,079,448 D299G probably damaging Het
Sptbn5 C T 2: 120,048,261 noncoding transcript Het
Srcap A G 7: 127,549,239 T1859A probably benign Het
Suox A G 10: 128,671,037 V374A probably damaging Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tubal3 C T 13: 3,932,946 S242L probably benign Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Other mutations in Cacna2d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Cacna2d4 APN 6 119337933 splice site probably benign
IGL00469:Cacna2d4 APN 6 119268278 missense probably damaging 1.00
IGL00518:Cacna2d4 APN 6 119343575 missense probably damaging 1.00
IGL00946:Cacna2d4 APN 6 119271915 missense possibly damaging 0.82
IGL01447:Cacna2d4 APN 6 119242904 missense probably damaging 1.00
IGL01514:Cacna2d4 APN 6 119282173 splice site probably benign
IGL01576:Cacna2d4 APN 6 119281641 nonsense probably null
IGL01934:Cacna2d4 APN 6 119308768 missense probably damaging 1.00
IGL02231:Cacna2d4 APN 6 119277908 splice site probably benign
IGL02516:Cacna2d4 APN 6 119271870 splice site probably benign
IGL02688:Cacna2d4 APN 6 119270749 splice site probably null
IGL03110:Cacna2d4 APN 6 119236737 missense probably benign 0.05
IGL03365:Cacna2d4 APN 6 119271264 missense probably benign 0.15
saccharine UTSW 6 119345106 splice site probably benign
Steveo UTSW 6 119347252 critical splice donor site probably null
Sussmann UTSW 6 119274318 missense probably damaging 1.00
R0139:Cacna2d4 UTSW 6 119278269 intron probably benign
R0157:Cacna2d4 UTSW 6 119312424 missense probably benign 0.00
R0158:Cacna2d4 UTSW 6 119236748 missense possibly damaging 0.68
R0245:Cacna2d4 UTSW 6 119308721 missense probably damaging 1.00
R0612:Cacna2d4 UTSW 6 119281718 splice site probably benign
R0659:Cacna2d4 UTSW 6 119345106 splice site probably benign
R0722:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0743:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0833:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0835:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0836:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0884:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1052:Cacna2d4 UTSW 6 119300333 missense probably damaging 1.00
R1168:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1170:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1451:Cacna2d4 UTSW 6 119236824 missense probably benign 0.01
R1564:Cacna2d4 UTSW 6 119241195 missense possibly damaging 0.67
R1809:Cacna2d4 UTSW 6 119270824 missense probably damaging 0.99
R1936:Cacna2d4 UTSW 6 119270761 missense possibly damaging 0.82
R2078:Cacna2d4 UTSW 6 119338116 missense probably benign 0.02
R2198:Cacna2d4 UTSW 6 119347259 splice site probably benign
R2280:Cacna2d4 UTSW 6 119350041 missense possibly damaging 0.85
R3757:Cacna2d4 UTSW 6 119241163 missense probably damaging 0.98
R3975:Cacna2d4 UTSW 6 119278173 intron probably null
R4238:Cacna2d4 UTSW 6 119240708 missense probably null 1.00
R4591:Cacna2d4 UTSW 6 119298464 missense probably benign 0.02
R4856:Cacna2d4 UTSW 6 119278256 missense possibly damaging 0.90
R4899:Cacna2d4 UTSW 6 119268196 nonsense probably null
R5319:Cacna2d4 UTSW 6 119347252 critical splice donor site probably null
R5351:Cacna2d4 UTSW 6 119268201 missense probably damaging 1.00
R5366:Cacna2d4 UTSW 6 119274318 missense probably damaging 1.00
R5393:Cacna2d4 UTSW 6 119239054 missense probably benign 0.20
R5395:Cacna2d4 UTSW 6 119271418 missense possibly damaging 0.71
R5408:Cacna2d4 UTSW 6 119348791 missense probably damaging 1.00
R5603:Cacna2d4 UTSW 6 119244285 missense probably damaging 1.00
R5661:Cacna2d4 UTSW 6 119343531 missense probably benign
R5898:Cacna2d4 UTSW 6 119274231 missense probably damaging 1.00
R5928:Cacna2d4 UTSW 6 119281698 missense probably benign 0.06
R6186:Cacna2d4 UTSW 6 119281689 missense possibly damaging 0.94
R6218:Cacna2d4 UTSW 6 119239060 missense probably damaging 0.99
R6257:Cacna2d4 UTSW 6 119281619 critical splice acceptor site probably null
R6409:Cacna2d4 UTSW 6 119282228 missense probably damaging 0.99
R6931:Cacna2d4 UTSW 6 119282234 missense possibly damaging 0.49
R7221:Cacna2d4 UTSW 6 119236663 missense probably benign 0.02
R7363:Cacna2d4 UTSW 6 119343978 missense probably damaging 1.00
R7371:Cacna2d4 UTSW 6 119308709 missense probably benign 0.07
R7382:Cacna2d4 UTSW 6 119239087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGATATAAGGTGAGCCTGAG -3'
(R):5'- AATGACCGTCGAGTTTCCTC -3'

Sequencing Primer
(F):5'- GGATGGTACCTAAGCCACAGC -3'
(R):5'- CTTGTATGATCTGAGGAATTTTAGCC -3'
Posted On2015-04-30