Incidental Mutation 'R0385:Dsg1c'
ID31265
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Namedesmoglein 1 gamma
SynonymsDsg6
MMRRC Submission 038591-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0385 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20247340-20285031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20283654 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 871 (P871S)
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
Predicted Effect probably damaging
Transcript: ENSMUST00000054128
AA Change: P871S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: P871S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,231,748 N331S probably benign Het
Adk A G 14: 21,318,074 N189S probably benign Het
Apc T A 18: 34,315,944 N1930K probably damaging Het
Arhgap28 T C 17: 67,864,606 D391G probably damaging Het
Atn1 G T 6: 124,743,371 probably benign Het
C2cd5 T C 6: 143,041,490 E471G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cap2 T C 13: 46,560,547 L34P probably damaging Het
Cdc42ep2 T A 19: 5,918,525 M51L probably benign Het
Cntn5 C T 9: 9,972,870 A254T probably damaging Het
Dicer1 A T 12: 104,704,174 L1044H probably damaging Het
Dkk3 A C 7: 112,158,223 M58R probably damaging Het
Dpy19l3 G A 7: 35,752,705 R5W probably damaging Het
Dusp1 A T 17: 26,507,696 S131T probably benign Het
Enpp2 C T 15: 54,882,159 G314R probably damaging Het
Fam222b C A 11: 78,154,930 P439Q probably benign Het
Fastkd2 A T 1: 63,737,811 I369F probably benign Het
Fdps G A 3: 89,094,894 S205F probably damaging Het
Fmo1 A T 1: 162,836,204 V252E possibly damaging Het
Frmd5 A G 2: 121,555,574 Y230H probably damaging Het
Gal C T 19: 3,411,171 V88I probably benign Het
Gm38394 A T 1: 133,656,784 D938E probably damaging Het
Gnptab T C 10: 88,436,525 I1009T probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klhdc7a A T 4: 139,966,705 D310E probably benign Het
Klk4 T C 7: 43,884,008 M97T probably benign Het
Krt82 C T 15: 101,545,593 V227M probably damaging Het
Lpp T C 16: 24,761,837 V226A probably damaging Het
Mbd1 AGCTGACTCGGTAC A 18: 74,273,241 probably null Het
Mcm10 T C 2: 5,004,154 K335E possibly damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myb T C 10: 21,154,712 D62G possibly damaging Het
Nasp A T 4: 116,610,695 N364K probably benign Het
Npsr1 A G 9: 24,313,277 N317D probably damaging Het
Nup210 A G 6: 91,028,795 V619A possibly damaging Het
Oser1 C T 2: 163,411,396 probably null Het
Pcdhb4 T C 18: 37,309,215 F526S probably damaging Het
Plekhh3 T C 11: 101,165,141 N444S probably damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Pou2f2 G A 7: 25,116,076 Q89* probably null Het
Ptprb A G 10: 116,350,178 I1713V probably benign Het
Ptprd A G 4: 76,128,665 Y442H probably damaging Het
Rad21 A T 15: 51,973,863 I152N possibly damaging Het
Ralgapa1 A G 12: 55,677,038 S1568P probably damaging Het
Rhag T A 17: 40,834,727 V357E probably damaging Het
Rnf121 A T 7: 102,029,117 D174E possibly damaging Het
Sdccag3 T C 2: 26,387,659 E41G possibly damaging Het
Sf3b4 T C 3: 96,172,982 Y16H probably damaging Het
Slc1a3 C T 15: 8,639,135 V449I probably damaging Het
Slc20a2 A G 8: 22,568,393 I648M probably benign Het
Slc25a25 T A 2: 32,417,822 I254F probably damaging Het
Slit3 A G 11: 35,700,282 H1307R probably damaging Het
Sorl1 C A 9: 42,031,909 M890I probably damaging Het
Supt16 A C 14: 52,176,718 M468R probably benign Het
Taf4b T C 18: 14,783,760 S56P probably benign Het
Tapt1 T C 5: 44,218,101 probably null Het
Tmco3 T G 8: 13,296,027 C288W probably damaging Het
Tpcn2 A G 7: 145,277,174 Y145H probably damaging Het
Ttn C T 2: 76,881,717 probably benign Het
Usb1 G T 8: 95,345,318 W215C probably damaging Het
Usp2 C G 9: 44,092,750 T305R probably damaging Het
Vmn1r13 G A 6: 57,210,705 S283N probably benign Het
Vps54 A G 11: 21,306,381 K467E possibly damaging Het
Wnk2 G T 13: 49,068,128 S1121Y probably damaging Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20274676 missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20281842 splice site probably benign
IGL01412:Dsg1c APN 18 20247461 missense probably benign
IGL02037:Dsg1c APN 18 20276950 missense probably benign 0.02
IGL02247:Dsg1c APN 18 20264316 missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20276999 missense probably benign
IGL02408:Dsg1c APN 18 20274719 missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20283733 missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20275192 missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20274830 missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20267929 missense probably benign 0.07
IGL03335:Dsg1c APN 18 20283697 missense probably benign 0.01
R0561:Dsg1c UTSW 18 20274775 missense probably benign 0.04
R0570:Dsg1c UTSW 18 20270378 missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20279241 missense probably benign 0.02
R0621:Dsg1c UTSW 18 20279695 missense possibly damaging 0.62
R0632:Dsg1c UTSW 18 20272346 splice site probably benign
R1183:Dsg1c UTSW 18 20283198 missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20282023 missense probably damaging 1.00
R1596:Dsg1c UTSW 18 20282047 missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20264842 missense probably benign 0.36
R1623:Dsg1c UTSW 18 20275177 missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20283039 splice site probably null
R1881:Dsg1c UTSW 18 20272540 splice site probably benign
R2017:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20275252 missense probably benign 0.09
R2319:Dsg1c UTSW 18 20275178 missense probably damaging 1.00
R2340:Dsg1c UTSW 18 20267888 missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20270350 missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20282058 critical splice donor site probably null
R3874:Dsg1c UTSW 18 20277052 missense probably benign 0.02
R3910:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20275265 missense probably benign 0.01
R4739:Dsg1c UTSW 18 20275189 missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20264844 missense probably benign 0.00
R5165:Dsg1c UTSW 18 20277023 missense probably damaging 1.00
R5210:Dsg1c UTSW 18 20274701 missense probably damaging 0.97
R5253:Dsg1c UTSW 18 20272379 missense probably damaging 1.00
R5327:Dsg1c UTSW 18 20267937 missense possibly damaging 0.75
R5361:Dsg1c UTSW 18 20283646 missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20282031 missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20272511 missense probably damaging 1.00
R5681:Dsg1c UTSW 18 20283213 missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20272351 missense probably benign 0.06
R5889:Dsg1c UTSW 18 20283601 missense possibly damaging 0.87
R6513:Dsg1c UTSW 18 20274630 missense probably benign 0.01
R6596:Dsg1c UTSW 18 20270524 intron probably null
R6941:Dsg1c UTSW 18 20267923 missense probably damaging 0.96
R7041:Dsg1c UTSW 18 20266144 missense probably damaging 1.00
R7061:Dsg1c UTSW 18 20277009 missense probably benign
R7240:Dsg1c UTSW 18 20283109 missense probably damaging 1.00
X0026:Dsg1c UTSW 18 20283258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGAGAATGCCTACCCCTCTGG -3'
(R):5'- TGCTAACAATGCCACTGCTGCC -3'

Sequencing Primer
(F):5'- CACTGTGAGGGAGTCCTATACTAC -3'
(R):5'- GGTGCCAGCAATTCCACTC -3'
Posted On2013-04-24