Incidental Mutation 'R4019:Sytl3'
ID312704
Institutional Source Beutler Lab
Gene Symbol Sytl3
Ensembl Gene ENSMUSG00000041831
Gene Namesynaptotagmin-like 3
SynonymsSlp3-b, Slp3-a, Slp3
MMRRC Submission 040953-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4019 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location6659093-6738044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6736493 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 326 (S326P)
Ref Sequence ENSEMBL: ENSMUSP00000123996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064234] [ENSMUST00000097430] [ENSMUST00000159394] [ENSMUST00000159880] [ENSMUST00000160483] [ENSMUST00000161118] [ENSMUST00000162635]
Predicted Effect probably benign
Transcript: ENSMUST00000064234
SMART Domains Protein: ENSMUSP00000063734
Gene: ENSMUSG00000052397

DomainStartEndE-ValueType
B41 1 206 7.74e-79 SMART
FERM_C 210 299 1.34e-35 SMART
Pfam:ERM 338 586 2.3e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097430
AA Change: S531P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095041
Gene: ENSMUSG00000041831
AA Change: S531P

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 6e-25 PFAM
low complexity region 162 170 N/A INTRINSIC
C2 321 426 9.17e-15 SMART
C2 478 601 1.92e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131131
Predicted Effect probably benign
Transcript: ENSMUST00000159394
SMART Domains Protein: ENSMUSP00000124146
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 3.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159880
AA Change: S336P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125469
Gene: ENSMUSG00000041831
AA Change: S336P

DomainStartEndE-ValueType
C2 116 221 9.17e-15 SMART
C2 273 396 1.92e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160483
AA Change: S326P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123996
Gene: ENSMUSG00000041831
AA Change: S326P

DomainStartEndE-ValueType
C2 126 231 9.17e-15 SMART
C2 283 406 1.92e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161118
Predicted Effect probably benign
Transcript: ENSMUST00000162635
SMART Domains Protein: ENSMUSP00000124496
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 4.3e-27 PFAM
low complexity region 158 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232362
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of peripheral membrane proteins that play a role in vesicular trafficking. This protein binds phospholipids in the presence of calcium ions. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 T C 9: 106,436,779 T61A possibly damaging Het
Ap4e1 C T 2: 127,061,926 S916F probably benign Het
Brpf1 G A 6: 113,310,282 R157Q probably damaging Het
Canx A T 11: 50,299,245 S429T probably damaging Het
Casz1 C T 4: 148,932,878 P208L probably benign Het
Ctnnd1 C T 2: 84,619,958 R306H probably damaging Het
Dip2c T C 13: 9,614,365 V909A probably damaging Het
Epg5 C A 18: 78,030,450 Q2511K probably damaging Het
Ghitm G A 14: 37,130,694 A143V probably damaging Het
Gm884 A G 11: 103,615,293 S1950P probably benign Het
Gramd3 T C 18: 56,478,954 probably null Het
Ifitm3 T C 7: 141,009,859 T94A possibly damaging Het
Ift81 G A 5: 122,593,129 T321M probably benign Het
Ikbkb C T 8: 22,671,712 V387I probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lpar5 A G 6: 125,081,675 N120D probably damaging Het
Lrrtm2 T C 18: 35,212,870 I460V possibly damaging Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nbas A G 12: 13,482,519 R1743G probably damaging Het
Notch1 T C 2: 26,481,142 T311A probably benign Het
Olfr1211 A G 2: 88,929,736 I193T probably benign Het
Olfr552 T C 7: 102,604,642 F96S probably damaging Het
Oplah A G 15: 76,297,276 Y1155H probably damaging Het
Pcnx C T 12: 81,918,244 T395I probably damaging Het
Pdgfb A C 15: 80,001,722 V108G probably damaging Het
Pdzd3 A T 9: 44,250,820 probably null Het
Prpf40b T C 15: 99,316,476 S846P probably benign Het
Ptprc T A 1: 138,078,516 H752L probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Scn3a A G 2: 65,525,951 probably benign Het
Sco1 T G 11: 67,064,020 S284A probably benign Het
Slc25a10 T A 11: 120,497,439 M227K probably damaging Het
Sox8 A G 17: 25,570,297 Y76H probably damaging Het
Spdya A C 17: 71,556,314 K19N possibly damaging Het
Syngap1 C T 17: 26,952,341 probably benign Het
Tbl3 A G 17: 24,704,721 V239A probably damaging Het
Tenm2 T C 11: 36,047,074 I1592V probably benign Het
Vmn2r109 T A 17: 20,553,812 D427V probably benign Het
Vmn2r115 A G 17: 23,360,043 K830R probably damaging Het
Vmn2r45 A T 7: 8,471,581 L816* probably null Het
Zfp335 C T 2: 164,901,460 R536H probably damaging Het
Zfp777 T A 6: 48,042,112 Q296L probably damaging Het
Other mutations in Sytl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Sytl3 APN 17 6735440 missense probably damaging 1.00
IGL02888:Sytl3 APN 17 6733084 missense probably benign
IGL02893:Sytl3 APN 17 6732974 missense probably damaging 1.00
R1462:Sytl3 UTSW 17 6706031 splice site probably benign
R1469:Sytl3 UTSW 17 6687324 missense probably benign 0.17
R1469:Sytl3 UTSW 17 6687324 missense probably benign 0.17
R1735:Sytl3 UTSW 17 6715481 missense probably benign 0.10
R1765:Sytl3 UTSW 17 6699683 missense probably damaging 0.98
R1834:Sytl3 UTSW 17 6728327 missense probably benign 0.05
R1933:Sytl3 UTSW 17 6733046 missense probably damaging 1.00
R1952:Sytl3 UTSW 17 6728333 missense probably damaging 1.00
R1992:Sytl3 UTSW 17 6733049 missense possibly damaging 0.79
R2279:Sytl3 UTSW 17 6708874 intron probably benign
R2411:Sytl3 UTSW 17 6736493 missense probably damaging 1.00
R4853:Sytl3 UTSW 17 6737765 missense probably damaging 0.97
R4857:Sytl3 UTSW 17 6736581 missense probably damaging 1.00
R5169:Sytl3 UTSW 17 6715546 nonsense probably null
R5485:Sytl3 UTSW 17 6715480 missense probably benign 0.03
R6035:Sytl3 UTSW 17 6728265 missense probably damaging 1.00
R6035:Sytl3 UTSW 17 6728265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTGTAGGGAGAAGGCAC -3'
(R):5'- CACTAAGGGCATAAAACCTGTGG -3'

Sequencing Primer
(F):5'- CTTGGGGGTCTAACCTAGATCAGC -3'
(R):5'- AACCTGTGGTTTTTCACTGAAC -3'
Posted On2015-04-30