Incidental Mutation 'R3880:Zfp345'
ID312772
Institutional Source Beutler Lab
Gene Symbol Zfp345
Ensembl Gene ENSMUSG00000074731
Gene Namezinc finger protein 345
SynonymsOTTMUSG00000015743
MMRRC Submission 040794-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R3880 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location150470991-150485091 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150472155 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 487 (I487M)
Ref Sequence ENSEMBL: ENSMUSP00000105540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109914]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109914
AA Change: I487M

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105540
Gene: ENSMUSG00000074731
AA Change: I487M

DomainStartEndE-ValueType
KRAB 4 66 9.5e-20 SMART
ZnF_C2H2 103 125 2e-2 SMART
ZnF_C2H2 131 153 2.9e-6 SMART
ZnF_C2H2 159 181 4.1e-3 SMART
ZnF_C2H2 215 237 2.6e-7 SMART
ZnF_C2H2 243 265 1.6e-5 SMART
ZnF_C2H2 271 293 4e-7 SMART
ZnF_C2H2 299 321 1.1e-5 SMART
ZnF_C2H2 327 349 5.9e-7 SMART
ZnF_C2H2 365 387 4.4e-7 SMART
ZnF_C2H2 393 415 7.3e-6 SMART
ZnF_C2H2 421 443 2.7e-5 SMART
ZnF_C2H2 449 471 1.5e-4 SMART
ZnF_C2H2 477 499 1.3e-5 SMART
ZnF_C2H2 505 527 5.1e-6 SMART
ZnF_C2H2 533 555 9.2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117906
Meta Mutation Damage Score 0.0548 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,639,233 W872R probably damaging Het
Abcg3 T C 5: 104,938,180 probably benign Het
Adgrv1 T A 13: 81,435,705 Q4627L probably benign Het
Armc2 T C 10: 41,963,725 I415V possibly damaging Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Bcas3 A G 11: 85,371,122 M107V probably benign Het
Ccdc43 T C 11: 102,692,203 probably null Het
Dtx4 A C 19: 12,486,456 S321A probably benign Het
Enox1 A T 14: 77,611,386 H379L possibly damaging Het
Evx1 A T 6: 52,313,861 D6V probably damaging Het
Fubp1 T A 3: 152,220,496 V286E probably damaging Het
Itgav T C 2: 83,768,301 V234A probably damaging Het
Khdc3 T C 9: 73,103,590 S241P possibly damaging Het
Lipc T A 9: 70,820,518 I16F probably damaging Het
Mael T C 1: 166,236,868 probably benign Het
Myo7b T G 18: 31,969,514 E1487A probably damaging Het
Olfr622 T G 7: 103,639,624 K172T probably benign Het
Osgin1 A G 8: 119,441,452 H6R probably benign Het
Otog C T 7: 46,288,021 T1718I possibly damaging Het
Otogl T C 10: 107,827,704 E1002G probably damaging Het
Pkd1l1 T C 11: 8,961,983 N241S unknown Het
Psmd9 C T 5: 123,234,590 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc6a2 C A 8: 92,990,218 N337K probably damaging Het
Snx19 A T 9: 30,462,392 Q917L probably damaging Het
Srsf3 T C 17: 29,036,283 V14A probably damaging Het
Sspo G A 6: 48,494,940 V4729I probably benign Het
Syngap1 T A 17: 26,953,064 I82N probably damaging Het
Telo2 A T 17: 25,106,833 M407K probably damaging Het
Thsd7b G A 1: 129,595,370 G47D probably damaging Het
Tradd A T 8: 105,260,655 N6K possibly damaging Het
Trim30a C A 7: 104,411,189 C460F probably benign Het
Trip13 T C 13: 73,918,478 Y318C probably damaging Het
Ubfd1 T A 7: 122,068,776 probably benign Het
Uggt1 A G 1: 36,176,804 probably benign Het
Wdr7 T A 18: 63,724,155 C101S possibly damaging Het
Other mutations in Zfp345
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Zfp345 APN 2 150472729 missense probably damaging 1.00
IGL00846:Zfp345 APN 2 150472618 missense possibly damaging 0.76
IGL01020:Zfp345 APN 2 150473047 missense possibly damaging 0.68
IGL01931:Zfp345 APN 2 150473350 missense probably benign 0.38
IGL02237:Zfp345 APN 2 150474885 splice site probably benign
IGL02335:Zfp345 APN 2 150474543 missense possibly damaging 0.92
IGL02592:Zfp345 APN 2 150473309 missense probably benign 0.36
IGL02736:Zfp345 APN 2 150474554 missense probably damaging 0.99
R0095:Zfp345 UTSW 2 150472300 missense probably damaging 1.00
R0096:Zfp345 UTSW 2 150472300 missense probably damaging 1.00
R0143:Zfp345 UTSW 2 150472555 missense probably benign
R0371:Zfp345 UTSW 2 150472063 missense possibly damaging 0.81
R0412:Zfp345 UTSW 2 150473403 missense probably benign 0.00
R0415:Zfp345 UTSW 2 150474559 splice site probably benign
R0420:Zfp345 UTSW 2 150473243 missense possibly damaging 0.74
R0697:Zfp345 UTSW 2 150472909 missense probably benign 0.13
R0799:Zfp345 UTSW 2 150472351 missense probably benign 0.27
R1881:Zfp345 UTSW 2 150472355 missense probably damaging 1.00
R1954:Zfp345 UTSW 2 150474821 missense probably damaging 1.00
R2004:Zfp345 UTSW 2 150472118 missense possibly damaging 0.90
R2152:Zfp345 UTSW 2 150472658 missense probably benign 0.00
R2153:Zfp345 UTSW 2 150472658 missense probably benign 0.00
R3051:Zfp345 UTSW 2 150474852 missense probably benign 0.07
R3939:Zfp345 UTSW 2 150472553 missense probably damaging 1.00
R4801:Zfp345 UTSW 2 150473308 missense possibly damaging 0.91
R4802:Zfp345 UTSW 2 150473308 missense possibly damaging 0.91
R4897:Zfp345 UTSW 2 150472688 missense probably benign 0.05
R5606:Zfp345 UTSW 2 150474868 nonsense probably null
R6009:Zfp345 UTSW 2 150472517 missense probably damaging 1.00
R6191:Zfp345 UTSW 2 150473090 missense probably benign 0.11
R6194:Zfp345 UTSW 2 150472631 missense probably damaging 1.00
R6782:Zfp345 UTSW 2 150473354 missense probably damaging 0.97
R6932:Zfp345 UTSW 2 150473411 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGAATACACTCATAGGGTTTCTC -3'
(R):5'- GAGTTCATACAGGAGAGAAACCTTATG -3'

Sequencing Primer
(F):5'- ATGTGTTCTAATATGCACTTGGAG -3'
(R):5'- ACAATGTGGTAAAGCCTTTGC -3'
Posted On2015-04-30