Incidental Mutation 'R0386:Elavl4'
ID31280
Institutional Source Beutler Lab
Gene Symbol Elavl4
Ensembl Gene ENSMUSG00000028546
Gene NameELAV like RNA binding protein 4
SynonymsHud
MMRRC Submission 038592-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R0386 (G1)
Quality Score166
Status Validated
Chromosome4
Chromosomal Location110203722-110351909 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 110206705 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102722] [ENSMUST00000102723] [ENSMUST00000106597] [ENSMUST00000106598] [ENSMUST00000106600] [ENSMUST00000106601] [ENSMUST00000106603]
Predicted Effect probably benign
Transcript: ENSMUST00000102722
SMART Domains Protein: ENSMUSP00000099783
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
RRM 52 125 7.57e-24 SMART
RRM 138 213 1.35e-20 SMART
low complexity region 219 233 N/A INTRINSIC
RRM 289 362 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102723
SMART Domains Protein: ENSMUSP00000099784
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 298 371 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106597
SMART Domains Protein: ENSMUSP00000102207
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
RRM 52 125 7.57e-24 SMART
RRM 138 213 1.35e-20 SMART
low complexity region 219 233 N/A INTRINSIC
RRM 303 376 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106598
SMART Domains Protein: ENSMUSP00000102208
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 284 357 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106600
SMART Domains Protein: ENSMUSP00000102210
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
RRM 64 137 7.57e-24 SMART
RRM 150 225 1.35e-20 SMART
low complexity region 231 245 N/A INTRINSIC
RRM 301 374 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106601
SMART Domains Protein: ENSMUSP00000102212
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 284 357 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106603
SMART Domains Protein: ENSMUSP00000102214
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
RRM 50 123 7.57e-24 SMART
RRM 136 211 1.35e-20 SMART
low complexity region 217 231 N/A INTRINSIC
RRM 274 347 2.37e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153200
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased neural progenitor self-renewal and impaired neuronal differentiation, partial penetrance of hind limb clasping, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,461 V194A probably damaging Het
Adamts13 G A 2: 26,986,679 probably null Het
Ahnak T C 19: 9,011,144 M3264T possibly damaging Het
Birc6 T A 17: 74,599,340 C1409S probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Dnah2 A G 11: 69,447,861 V3161A probably damaging Het
Dnah5 A T 15: 28,383,581 Y2983F probably damaging Het
Dnah6 G A 6: 73,083,124 L2774F probably damaging Het
Dst A T 1: 34,217,836 T4398S probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Efcab5 A T 11: 77,172,378 M96K probably benign Het
Flt4 G A 11: 49,644,386 A1214T probably benign Het
Fn1 G T 1: 71,595,786 T2127N probably damaging Het
Foxj1 A T 11: 116,331,803 S391R possibly damaging Het
Gabrb1 A T 5: 72,108,807 Y269F probably damaging Het
Ghitm A G 14: 37,125,911 S259P possibly damaging Het
Gm16332 A G 1: 139,924,190 noncoding transcript Het
Gm16380 T A 9: 53,884,443 noncoding transcript Het
Gm9869 A T 9: 60,838,062 probably benign Het
Gm9936 G A 5: 114,857,131 Q142* probably null Het
Hmbs T C 9: 44,337,008 Y260C probably benign Het
Hoxc5 T A 15: 103,015,352 C193* probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Lce1j T C 3: 92,789,388 K28E unknown Het
Lpgat1 C T 1: 191,719,348 probably benign Het
Lyst T C 13: 13,708,214 probably benign Het
Megf11 A G 9: 64,640,078 N235D probably damaging Het
Mst1r T A 9: 107,916,804 probably null Het
Nr2c2ap A G 8: 70,131,587 D9G probably benign Het
Obscn T C 11: 59,136,339 T13A probably damaging Het
Ofcc1 A C 13: 40,214,474 L188* probably null Het
Olfr1028 A G 2: 85,951,873 E270G probably damaging Het
Olfr432 A T 1: 174,050,399 T9S probably benign Het
Oma1 A T 4: 103,325,201 probably benign Het
Pcm1 T C 8: 41,316,023 F1642S probably damaging Het
Pglyrp2 A G 17: 32,420,862 M1T probably null Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm10 C A 9: 31,316,300 T67K probably damaging Het
Ralgapa1 A T 12: 55,708,067 H1193Q probably benign Het
Sall1 A G 8: 89,032,604 S291P probably damaging Het
Sdk2 T C 11: 113,893,464 T150A probably damaging Het
Sel1l2 T A 2: 140,275,441 Y170F probably benign Het
Sema4a C T 3: 88,436,800 V715I possibly damaging Het
Smgc G A 15: 91,854,638 A500T probably benign Het
Spef2 A G 15: 9,584,062 V1639A probably damaging Het
Srrm4 A G 5: 116,482,378 probably benign Het
Tbc1d23 G A 16: 57,189,273 H418Y probably damaging Het
Tbk1 A G 10: 121,584,254 L10P probably damaging Het
Thumpd3 G A 6: 113,065,660 probably null Het
Trp53bp1 G T 2: 121,204,943 T1609K probably damaging Het
Tut1 A G 19: 8,955,555 N84S probably benign Het
Urb1 C T 16: 90,796,399 G282R probably damaging Het
Usp19 A T 9: 108,499,711 D1160V probably damaging Het
Usp9y A G Y: 1,316,933 V1872A probably damaging Het
Zfp276 C A 8: 123,259,503 Y386* probably null Het
Other mutations in Elavl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Elavl4 APN 4 110206612 missense probably benign 0.03
IGL01777:Elavl4 APN 4 110206661 critical splice acceptor site probably null
IGL02212:Elavl4 APN 4 110206412 missense probably damaging 1.00
IGL03053:Elavl4 APN 4 110251494 missense possibly damaging 0.89
R1141:Elavl4 UTSW 4 110251368 nonsense probably null
R1826:Elavl4 UTSW 4 110251292 missense probably damaging 1.00
R5155:Elavl4 UTSW 4 110292636 missense probably null 0.22
R5294:Elavl4 UTSW 4 110211430 missense possibly damaging 0.90
R5507:Elavl4 UTSW 4 110213206 missense probably benign 0.17
R5558:Elavl4 UTSW 4 110206603 missense probably benign 0.37
R5927:Elavl4 UTSW 4 110290243 unclassified probably benign
R5987:Elavl4 UTSW 4 110290644 missense probably benign 0.40
R6376:Elavl4 UTSW 4 110255454 start gained probably benign
R6504:Elavl4 UTSW 4 110255382 intron probably null
R6987:Elavl4 UTSW 4 110251405 missense possibly damaging 0.70
R7278:Elavl4 UTSW 4 110211425 critical splice donor site probably null
R7431:Elavl4 UTSW 4 110226633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAGTCACGGATGACCTTGACG -3'
(R):5'- TGAACCAGAGTCCCTTCCCCATAG -3'

Sequencing Primer
(F):5'- GTTGTTCACTGCGCCAAAG -3'
(R):5'- AATTCACAGTCTATGGCCGGG -3'
Posted On2013-04-24