Incidental Mutation 'R3882:Jup'
ID312822
Institutional Source Beutler Lab
Gene Symbol Jup
Ensembl Gene ENSMUSG00000001552
Gene Namejunction plakoglobin
SynonymsPG, gamma-catenin, Ctnng, plakoglobin, D930025P04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3882 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100368958-100397763 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100378381 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 402 (V402A)
Ref Sequence ENSEMBL: ENSMUSP00000103026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001592] [ENSMUST00000107403]
Predicted Effect probably benign
Transcript: ENSMUST00000001592
AA Change: V402A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001592
Gene: ENSMUSG00000001552
AA Change: V402A

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
ARM 132 171 3.58e1 SMART
ARM 172 214 4.03e1 SMART
ARM 215 255 1.07e-4 SMART
ARM 256 297 1.66e-1 SMART
ARM 299 340 1.86e1 SMART
ARM 341 381 9.23e-9 SMART
ARM 382 420 2.29e1 SMART
ARM 422 464 7.34e-3 SMART
ARM 469 510 8.3e-2 SMART
ARM 511 572 7.45e-4 SMART
ARM 573 613 5.35e-5 SMART
ARM 614 654 1.56e1 SMART
low complexity region 708 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107403
AA Change: V402A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103026
Gene: ENSMUSG00000001552
AA Change: V402A

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
ARM 132 171 3.58e1 SMART
ARM 172 214 4.03e1 SMART
ARM 215 255 1.07e-4 SMART
ARM 256 297 1.66e-1 SMART
ARM 299 340 1.86e1 SMART
ARM 341 381 9.23e-9 SMART
ARM 382 420 2.29e1 SMART
ARM 422 464 7.34e-3 SMART
ARM 469 510 8.3e-2 SMART
ARM 511 572 7.45e-4 SMART
ARM 573 613 5.35e-5 SMART
ARM 614 654 1.56e1 SMART
low complexity region 708 723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155746
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major cytoplasmic protein which is the only known constituent common to submembranous plaques of both desmosomes and intermediate junctions. This protein forms distinct complexes with cadherins and desmosomal cadherins and is a member of the catenin family since it contains a distinct repeating amino acid motif called the armadillo repeat. Mutation in this gene has been associated with Naxos disease. Alternative splicing occurs in this gene; however, not all transcripts have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die with severe heart defects at embryonic day 10.5-16, depending on genetic background. Mutants that survive to birth exhibit skin blistering and subcorneal acantholysis associated with reduced number of desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,700 W24R probably damaging Het
Acy1 G T 9: 106,435,509 T181K possibly damaging Het
Adcy4 A G 14: 55,774,546 F581L probably benign Het
Amhr2 G A 15: 102,445,898 G48D probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgef17 A G 7: 100,876,454 F1979S possibly damaging Het
C2 T C 17: 34,873,489 T191A probably benign Het
Cmya5 T A 13: 93,091,219 T2454S probably benign Het
Dstn A G 2: 143,942,187 E150G probably benign Het
Dync1h1 G T 12: 110,629,058 V1444F probably benign Het
Eif3f T C 7: 108,940,955 V319A possibly damaging Het
Gpha2 T C 19: 6,226,889 probably null Het
Hps5 A G 7: 46,771,996 V648A possibly damaging Het
Kif18a A G 2: 109,306,974 N517S probably benign Het
Kif20b T A 19: 34,950,080 I874N probably damaging Het
Lepr T A 4: 101,815,265 V1162E probably damaging Het
Man2a2 A T 7: 80,362,315 V698D possibly damaging Het
Miip A C 4: 147,861,052 S376A possibly damaging Het
Nsun7 G A 5: 66,278,640 R285Q probably damaging Het
Nup210l T C 3: 90,124,210 V281A probably benign Het
Paxip1 C T 5: 27,748,839 R953Q probably damaging Het
Pcdha8 C A 18: 36,993,046 L194I probably damaging Het
Pcdha8 A G 18: 36,993,571 I369V probably benign Het
Pcdhga10 C A 18: 37,747,441 A85E possibly damaging Het
Ppfibp1 A G 6: 146,998,221 R137G possibly damaging Het
Rcor1 C T 12: 111,103,753 A230V probably damaging Het
Scn3a T C 2: 65,482,279 M1191V probably benign Het
Skor2 A G 18: 76,862,689 D904G probably damaging Het
Suco A T 1: 161,834,744 V706E probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Vmn1r83 A T 7: 12,321,402 C243S probably damaging Het
Wdr17 A T 8: 54,639,501 C1083S possibly damaging Het
Zfp952 G T 17: 33,001,975 E18* probably null Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Zscan25 G T 5: 145,291,052 G509C probably damaging Het
Other mutations in Jup
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Jup APN 11 100386249 missense probably benign
IGL01797:Jup APN 11 100381672 splice site probably benign
IGL01926:Jup APN 11 100383586 missense probably benign 0.00
IGL02030:Jup APN 11 100376991 missense probably damaging 0.96
IGL02073:Jup APN 11 100383389 splice site probably benign
IGL02218:Jup APN 11 100381839 missense probably damaging 1.00
IGL02450:Jup APN 11 100378357 missense probably damaging 1.00
IGL02955:Jup APN 11 100376739 missense probably benign 0.31
IGL02976:Jup APN 11 100378366 missense probably benign 0.40
IGL03023:Jup APN 11 100380692 splice site probably benign
IGL02802:Jup UTSW 11 100378378 missense probably benign
PIT4403001:Jup UTSW 11 100378087 critical splice donor site probably null
R0426:Jup UTSW 11 100372401 missense probably benign 0.02
R0626:Jup UTSW 11 100376763 missense probably benign
R1330:Jup UTSW 11 100372676 missense probably benign 0.02
R1437:Jup UTSW 11 100383576 missense probably benign 0.06
R1448:Jup UTSW 11 100383200 missense probably damaging 1.00
R1473:Jup UTSW 11 100379601 missense possibly damaging 0.79
R1686:Jup UTSW 11 100372434 missense probably damaging 0.96
R1824:Jup UTSW 11 100374137 nonsense probably null
R1875:Jup UTSW 11 100372294 unclassified probably null
R2017:Jup UTSW 11 100386341 missense probably benign 0.01
R2989:Jup UTSW 11 100376841 missense possibly damaging 0.92
R3881:Jup UTSW 11 100378381 missense probably benign
R4176:Jup UTSW 11 100372461 missense probably benign 0.03
R4612:Jup UTSW 11 100381834 missense probably damaging 0.98
R4808:Jup UTSW 11 100378192 missense probably damaging 0.99
R4854:Jup UTSW 11 100383041 missense possibly damaging 0.73
R4995:Jup UTSW 11 100379541 nonsense probably null
R5133:Jup UTSW 11 100383115 missense probably benign 0.02
R5408:Jup UTSW 11 100376781 missense probably damaging 1.00
R5641:Jup UTSW 11 100376806 missense possibly damaging 0.62
R5991:Jup UTSW 11 100379569 missense possibly damaging 0.59
R6431:Jup UTSW 11 100374341 missense probably benign 0.01
R6805:Jup UTSW 11 100383458 missense probably benign 0.17
R7022:Jup UTSW 11 100379553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGTTGAGGCGCACAGAGTTC -3'
(R):5'- CAAGGTTCCCAGCTAGATACAAG -3'

Sequencing Primer
(F):5'- AGAGTTCTGGGCCATCTCAG -3'
(R):5'- GTTCCCAGCTAGATACAAGCAAGC -3'
Posted On2015-04-30