Incidental Mutation 'R3888:Lct'
ID312843
Institutional Source Beutler Lab
Gene Symbol Lct
Ensembl Gene ENSMUSG00000026354
Gene Namelactase
SynonymsLPH, LOC226413, Lphl
MMRRC Submission 040800-MU
Accession Numbers

Genbank: NM_001081078; MGI:104576

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3888 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location128284756-128328318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128304226 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 629 (M629V)
Ref Sequence ENSEMBL: ENSMUSP00000073190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073490]
Predicted Effect probably damaging
Transcript: ENSMUST00000073490
AA Change: M629V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: M629V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 76 226 1.6e-19 PFAM
low complexity region 322 340 N/A INTRINSIC
Pfam:Glyco_hydro_1 380 849 4.8e-169 PFAM
low complexity region 865 875 N/A INTRINSIC
Pfam:Glyco_hydro_1 902 1368 3.7e-181 PFAM
Pfam:Glyco_hydro_1 1377 1844 6.9e-183 PFAM
transmembrane domain 1885 1907 N/A INTRINSIC
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Acbd6 A G 1: 155,624,897 D201G probably damaging Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
Ano3 T A 2: 110,885,000 K31I probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cmya5 T G 13: 93,093,656 R1641S probably benign Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Frem1 T C 4: 82,913,607 R1991G probably benign Het
Gimap7 G A 6: 48,723,845 E122K probably benign Het
Hps3 A G 3: 20,003,223 probably null Het
Kctd2 A T 11: 115,427,519 K209N probably damaging Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Muc5ac T C 7: 141,791,224 V144A possibly damaging Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Ntf3 T C 6: 126,102,442 M21V probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr1447 A T 19: 12,901,133 C216S probably benign Het
Olfr802 G A 10: 129,682,218 H174Y possibly damaging Het
Olfr802 A T 10: 129,682,219 D173E probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Slc12a6 T A 2: 112,267,030 L70Q possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Smim17 G T 7: 6,429,280 G74C probably damaging Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Suv39h2 G A 2: 3,464,808 T170I probably benign Het
Thrb A G 14: 18,033,551 K424R probably damaging Het
Tm4sf4 C T 3: 57,437,745 Q191* probably null Het
Trak1 G T 9: 121,442,797 probably null Het
Ttn A G 2: 76,710,274 S25796P probably damaging Het
Ugp2 T C 11: 21,353,366 R80G probably benign Het
Utp15 C T 13: 98,259,166 V103I probably benign Het
Wdr3 A T 3: 100,153,906 S249T probably benign Het
Zeb1 T A 18: 5,748,743 D86E probably damaging Het
Other mutations in Lct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Lct APN 1 128287556 missense probably benign 0.09
IGL00970:Lct APN 1 128304068 missense probably damaging 1.00
IGL01022:Lct APN 1 128300859 missense probably benign
IGL01878:Lct APN 1 128294266 missense probably damaging 1.00
IGL01892:Lct APN 1 128307605 missense probably damaging 1.00
IGL02307:Lct APN 1 128286590 missense possibly damaging 0.70
IGL02434:Lct APN 1 128303790 missense probably damaging 0.97
IGL02559:Lct APN 1 128294266 missense probably damaging 1.00
IGL02623:Lct APN 1 128308251 missense probably benign 0.01
IGL02818:Lct APN 1 128300168 missense probably damaging 1.00
IGL02949:Lct APN 1 128313132 missense probably benign 0.26
IGL02951:Lct APN 1 128300211 missense probably damaging 1.00
IGL03087:Lct APN 1 128300375 missense possibly damaging 0.81
IGL03227:Lct APN 1 128327689 missense probably benign 0.09
ANU18:Lct UTSW 1 128308047 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0135:Lct UTSW 1 128285123 missense probably damaging 0.98
R0145:Lct UTSW 1 128327895 missense probably benign 0.00
R0179:Lct UTSW 1 128327685 missense probably benign
R0331:Lct UTSW 1 128298742 splice site probably benign
R0366:Lct UTSW 1 128286462 missense probably benign 0.03
R0399:Lct UTSW 1 128300525 missense probably damaging 1.00
R0492:Lct UTSW 1 128300582 missense probably damaging 1.00
R0548:Lct UTSW 1 128285195 missense probably damaging 1.00
R0691:Lct UTSW 1 128308234 missense probably benign 0.00
R0755:Lct UTSW 1 128294135 missense possibly damaging 0.46
R0839:Lct UTSW 1 128286609 missense probably benign 0.00
R1128:Lct UTSW 1 128301309 missense probably damaging 0.99
R1135:Lct UTSW 1 128294124 critical splice donor site probably null
R1321:Lct UTSW 1 128300022 missense probably benign
R1448:Lct UTSW 1 128307822 missense probably damaging 0.99
R1450:Lct UTSW 1 128307903 missense probably damaging 1.00
R1572:Lct UTSW 1 128294195 missense probably benign 0.25
R1582:Lct UTSW 1 128300562 missense probably damaging 1.00
R1668:Lct UTSW 1 128287722 splice site probably null
R1757:Lct UTSW 1 128301257 missense probably damaging 1.00
R1775:Lct UTSW 1 128300301 missense probably damaging 1.00
R1792:Lct UTSW 1 128327942 missense possibly damaging 0.54
R1815:Lct UTSW 1 128300159 missense probably damaging 1.00
R1932:Lct UTSW 1 128294161 missense probably damaging 1.00
R2325:Lct UTSW 1 128304226 missense probably damaging 1.00
R2381:Lct UTSW 1 128304121 nonsense probably null
R3001:Lct UTSW 1 128304226 missense probably damaging 1.00
R3002:Lct UTSW 1 128304226 missense probably damaging 1.00
R3003:Lct UTSW 1 128304226 missense probably damaging 1.00
R3011:Lct UTSW 1 128301372 missense possibly damaging 0.74
R3082:Lct UTSW 1 128287608 missense probably damaging 1.00
R3683:Lct UTSW 1 128304226 missense probably damaging 1.00
R3684:Lct UTSW 1 128304226 missense probably damaging 1.00
R3726:Lct UTSW 1 128304226 missense probably damaging 1.00
R3886:Lct UTSW 1 128304226 missense probably damaging 1.00
R3887:Lct UTSW 1 128304226 missense probably damaging 1.00
R4019:Lct UTSW 1 128304226 missense probably damaging 1.00
R4027:Lct UTSW 1 128285181 missense probably benign 0.00
R4226:Lct UTSW 1 128304226 missense probably damaging 1.00
R4409:Lct UTSW 1 128304226 missense probably damaging 1.00
R4514:Lct UTSW 1 128300514 missense probably benign
R4570:Lct UTSW 1 128299904 missense probably benign 0.01
R4776:Lct UTSW 1 128300387 missense probably damaging 0.99
R5001:Lct UTSW 1 128308241 missense probably damaging 0.96
R5021:Lct UTSW 1 128300565 missense probably benign 0.38
R5318:Lct UTSW 1 128304372 missense probably damaging 1.00
R5330:Lct UTSW 1 128298529 missense probably benign 0.06
R5385:Lct UTSW 1 128311617 missense possibly damaging 0.63
R5499:Lct UTSW 1 128286677 missense probably damaging 1.00
R5508:Lct UTSW 1 128294131 missense probably damaging 1.00
R5642:Lct UTSW 1 128295232 missense probably damaging 1.00
R5724:Lct UTSW 1 128300336 missense probably benign
R6026:Lct UTSW 1 128300018 missense probably benign
R6044:Lct UTSW 1 128307980 missense possibly damaging 0.95
R6175:Lct UTSW 1 128327714 missense probably damaging 1.00
R6277:Lct UTSW 1 128304237 missense probably benign 0.01
R6412:Lct UTSW 1 128327718 missense probably benign 0.00
R6480:Lct UTSW 1 128294320 missense probably damaging 1.00
R6526:Lct UTSW 1 128300478 missense probably benign 0.05
R6620:Lct UTSW 1 128295072 critical splice donor site probably null
R7214:Lct UTSW 1 128300460 missense probably benign 0.00
R7308:Lct UTSW 1 128319087 missense probably benign 0.00
X0052:Lct UTSW 1 128307630 missense probably damaging 1.00
YA93:Lct UTSW 1 128301320 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCATAGCTGGGGATGCAGG -3'
(R):5'- TGGCTCACCTGATCCTCAAG -3'

Sequencing Primer
(F):5'- CCTTGCTGATGAGGCGG -3'
(R):5'- TGATCCTCAAGGCGCATG -3'
Posted On2015-04-30