Incidental Mutation 'R0386:Zfp276'
ID31290
Institutional Source Beutler Lab
Gene Symbol Zfp276
Ensembl Gene ENSMUSG00000001065
Gene Namezinc finger protein (C2H2 type) 276
SynonymsD8Ertd370e, D8Ertd377e
MMRRC Submission 038592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R0386 (G1)
Quality Score193
Status Validated
Chromosome8
Chromosomal Location123254195-123269745 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 123259503 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 386 (Y386*)
Ref Sequence ENSEMBL: ENSMUSP00000001092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001092] [ENSMUST00000127664] [ENSMUST00000154450]
Predicted Effect probably null
Transcript: ENSMUST00000001092
AA Change: Y386*
SMART Domains Protein: ENSMUSP00000001092
Gene: ENSMUSG00000001065
AA Change: Y386*

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.2e-13 PFAM
low complexity region 402 422 N/A INTRINSIC
ZnF_C2H2 434 458 2.24e-3 SMART
ZnF_C2H2 465 490 6.67e-2 SMART
ZnF_C2H2 496 518 1.38e-3 SMART
ZnF_C2H2 524 546 1.82e-3 SMART
ZnF_C2H2 554 577 4.79e-3 SMART
low complexity region 586 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150356
Predicted Effect probably benign
Transcript: ENSMUST00000154450
SMART Domains Protein: ENSMUSP00000119771
Gene: ENSMUSG00000001065

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.9e-14 PFAM
low complexity region 183 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211828
Meta Mutation Damage Score 0.636 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,461 V194A probably damaging Het
Adamts13 G A 2: 26,986,679 probably null Het
Ahnak T C 19: 9,011,144 M3264T possibly damaging Het
Birc6 T A 17: 74,599,340 C1409S probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Dnah2 A G 11: 69,447,861 V3161A probably damaging Het
Dnah5 A T 15: 28,383,581 Y2983F probably damaging Het
Dnah6 G A 6: 73,083,124 L2774F probably damaging Het
Dst A T 1: 34,217,836 T4398S probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Efcab5 A T 11: 77,172,378 M96K probably benign Het
Elavl4 A G 4: 110,206,705 probably benign Het
Flt4 G A 11: 49,644,386 A1214T probably benign Het
Fn1 G T 1: 71,595,786 T2127N probably damaging Het
Foxj1 A T 11: 116,331,803 S391R possibly damaging Het
Gabrb1 A T 5: 72,108,807 Y269F probably damaging Het
Ghitm A G 14: 37,125,911 S259P possibly damaging Het
Gm16332 A G 1: 139,924,190 noncoding transcript Het
Gm16380 T A 9: 53,884,443 noncoding transcript Het
Gm9869 A T 9: 60,838,062 probably benign Het
Gm9936 G A 5: 114,857,131 Q142* probably null Het
Hmbs T C 9: 44,337,008 Y260C probably benign Het
Hoxc5 T A 15: 103,015,352 C193* probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Lce1j T C 3: 92,789,388 K28E unknown Het
Lpgat1 C T 1: 191,719,348 probably benign Het
Lyst T C 13: 13,708,214 probably benign Het
Megf11 A G 9: 64,640,078 N235D probably damaging Het
Mst1r T A 9: 107,916,804 probably null Het
Nr2c2ap A G 8: 70,131,587 D9G probably benign Het
Obscn T C 11: 59,136,339 T13A probably damaging Het
Ofcc1 A C 13: 40,214,474 L188* probably null Het
Olfr1028 A G 2: 85,951,873 E270G probably damaging Het
Olfr432 A T 1: 174,050,399 T9S probably benign Het
Oma1 A T 4: 103,325,201 probably benign Het
Pcm1 T C 8: 41,316,023 F1642S probably damaging Het
Pglyrp2 A G 17: 32,420,862 M1T probably null Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm10 C A 9: 31,316,300 T67K probably damaging Het
Ralgapa1 A T 12: 55,708,067 H1193Q probably benign Het
Sall1 A G 8: 89,032,604 S291P probably damaging Het
Sdk2 T C 11: 113,893,464 T150A probably damaging Het
Sel1l2 T A 2: 140,275,441 Y170F probably benign Het
Sema4a C T 3: 88,436,800 V715I possibly damaging Het
Smgc G A 15: 91,854,638 A500T probably benign Het
Spef2 A G 15: 9,584,062 V1639A probably damaging Het
Srrm4 A G 5: 116,482,378 probably benign Het
Tbc1d23 G A 16: 57,189,273 H418Y probably damaging Het
Tbk1 A G 10: 121,584,254 L10P probably damaging Het
Thumpd3 G A 6: 113,065,660 probably null Het
Trp53bp1 G T 2: 121,204,943 T1609K probably damaging Het
Tut1 A G 19: 8,955,555 N84S probably benign Het
Urb1 C T 16: 90,796,399 G282R probably damaging Het
Usp19 A T 9: 108,499,711 D1160V probably damaging Het
Usp9y A G Y: 1,316,933 V1872A probably damaging Het
Other mutations in Zfp276
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Zfp276 APN 8 123258337 missense probably benign 0.01
IGL02573:Zfp276 APN 8 123264997 missense probably damaging 1.00
IGL02729:Zfp276 APN 8 123267816 missense probably damaging 1.00
IGL02956:Zfp276 APN 8 123254744 missense probably damaging 1.00
IGL03019:Zfp276 APN 8 123267934 missense probably damaging 1.00
R0087:Zfp276 UTSW 8 123265047 missense probably damaging 1.00
R1084:Zfp276 UTSW 8 123254723 missense probably damaging 0.99
R4199:Zfp276 UTSW 8 123267825 missense probably damaging 1.00
R4506:Zfp276 UTSW 8 123264927 critical splice donor site probably null
R4584:Zfp276 UTSW 8 123268406 utr 3 prime probably benign
R4776:Zfp276 UTSW 8 123254884 missense probably benign
R4985:Zfp276 UTSW 8 123267907 missense probably damaging 1.00
R5017:Zfp276 UTSW 8 123264977 unclassified probably benign
R5018:Zfp276 UTSW 8 123264977 unclassified probably benign
R5115:Zfp276 UTSW 8 123264977 unclassified probably benign
R5116:Zfp276 UTSW 8 123264977 unclassified probably benign
R5412:Zfp276 UTSW 8 123255781 missense probably damaging 1.00
R5436:Zfp276 UTSW 8 123265282 unclassified probably benign
R5822:Zfp276 UTSW 8 123255718 missense probably benign
R6059:Zfp276 UTSW 8 123267823 missense probably damaging 1.00
R6186:Zfp276 UTSW 8 123255933 nonsense probably null
R6947:Zfp276 UTSW 8 123254904 missense probably benign
R6975:Zfp276 UTSW 8 123256831 nonsense probably null
R7313:Zfp276 UTSW 8 123267823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTATGGGGTCTGTAGCCCTGAAG -3'
(R):5'- TCTGAGATGGACACCTACGACCAAC -3'

Sequencing Primer
(F):5'- TCTGTAGCCCTGAAGACAGGAG -3'
(R):5'- GTGGAAATGGTTCTCTGACACAC -3'
Posted On2013-04-24