Incidental Mutation 'R3942:Irx5'
ID312903
Institutional Source Beutler Lab
Gene Symbol Irx5
Ensembl Gene ENSMUSG00000031737
Gene NameIroquois homeobox 5
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3942 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location92357625-92376286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92359686 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 132 (N132K)
Ref Sequence ENSEMBL: ENSMUSP00000034184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034184] [ENSMUST00000210246]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034183
Predicted Effect probably damaging
Transcript: ENSMUST00000034184
AA Change: N132K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034184
Gene: ENSMUSG00000031737
AA Change: N132K

DomainStartEndE-ValueType
HOX 112 177 1.14e-12 SMART
low complexity region 185 202 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
low complexity region 307 327 N/A INTRINSIC
IRO 328 345 2.28e-5 SMART
low complexity region 351 369 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
low complexity region 417 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180102
Predicted Effect probably damaging
Transcript: ENSMUST00000210246
AA Change: N132K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, narrow eye opening, and impaired retinal cone bipolar cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,182,789 N6049S probably damaging Het
Aph1a C T 3: 95,894,261 R31W probably damaging Het
Atp10b T C 11: 43,172,754 V172A probably damaging Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Best3 T A 10: 116,988,674 F15Y possibly damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Crb1 A C 1: 139,337,473 L69R possibly damaging Het
Crcp T C 5: 130,034,950 probably null Het
Dysf G A 6: 84,186,509 probably null Het
Gm5724 A G 6: 141,727,714 I366T probably damaging Het
Hps3 T C 3: 19,996,939 Y859C probably damaging Het
Itgb2 A G 10: 77,558,033 T436A probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Krt12 A G 11: 99,422,096 S41P unknown Het
Lypd6b G T 2: 49,943,540 S64I probably damaging Het
Mpc1 T A 17: 8,288,588 probably null Het
Olfr1214 T A 2: 88,988,111 L30F probably benign Het
Olfr1443 A T 19: 12,680,404 M99L probably benign Het
Pard3b T A 1: 62,159,452 I233N probably damaging Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Pclo A G 5: 14,679,918 probably benign Het
Pkhd1l1 T C 15: 44,592,026 probably null Het
Spata31d1d T C 13: 59,727,462 Q753R probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Trav6-5 T C 14: 53,491,381 S32P probably benign Het
Zp3r A C 1: 130,577,054 D470E possibly damaging Het
Other mutations in Irx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Irx5 APN 8 92360703 missense probably damaging 1.00
IGL01870:Irx5 APN 8 92359777 missense probably damaging 1.00
IGL01985:Irx5 APN 8 92359527 splice site probably benign
IGL02481:Irx5 APN 8 92360679 missense probably damaging 1.00
IGL02597:Irx5 APN 8 92360772 missense possibly damaging 0.93
IGL03257:Irx5 APN 8 92360630 missense probably benign 0.00
R0784:Irx5 UTSW 8 92360490 missense probably benign
R1498:Irx5 UTSW 8 92359886 missense probably damaging 1.00
R1762:Irx5 UTSW 8 92359644 missense probably damaging 1.00
R1783:Irx5 UTSW 8 92359688 missense probably damaging 1.00
R1951:Irx5 UTSW 8 92359810 missense probably damaging 1.00
R1953:Irx5 UTSW 8 92359810 missense probably damaging 1.00
R2019:Irx5 UTSW 8 92358364 missense probably damaging 1.00
R3875:Irx5 UTSW 8 92360165 missense probably benign 0.00
R4361:Irx5 UTSW 8 92358397 missense probably damaging 0.99
R4574:Irx5 UTSW 8 92358262 missense probably damaging 0.99
R4994:Irx5 UTSW 8 92360781 missense probably damaging 1.00
R5579:Irx5 UTSW 8 92359913 missense probably benign 0.01
R5884:Irx5 UTSW 8 92360630 missense possibly damaging 0.95
R5988:Irx5 UTSW 8 92360671 nonsense probably null
R6017:Irx5 UTSW 8 92358250 missense probably damaging 1.00
R6339:Irx5 UTSW 8 92359853 missense probably damaging 0.99
R6466:Irx5 UTSW 8 92359726 missense probably damaging 1.00
R6595:Irx5 UTSW 8 92359619 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGCACTCAAAACCAAGG -3'
(R):5'- GCATCCACCAACCTGATTCG -3'

Sequencing Primer
(F):5'- GCTATGTAGCCCACACCCTC -3'
(R):5'- AACCTGATTCGGGGCCCTC -3'
Posted On2015-04-30