Incidental Mutation 'R3973:Crot'
ID312930
Institutional Source Beutler Lab
Gene Symbol Crot
Ensembl Gene ENSMUSG00000003623
Gene Namecarnitine O-octanoyltransferase
Synonyms1200003H03Rik
MMRRC Submission 040841-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R3973 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location8966033-8997324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8977541 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 264 (T264A)
Ref Sequence ENSEMBL: ENSMUSP00000003720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003720]
PDB Structure
Crystal Structure of Mouse Carnitine Octanoyltransferase [X-RAY DIFFRACTION]
Crystal structure of mouse carnitine octanoyltransferase in complex with octanoylcarnitine [X-RAY DIFFRACTION]
C323M mutant structure of mouse carnitine octanoyltransferase [X-RAY DIFFRACTION]
M335V mutant structure of mouse carnitine octanoyltransferase [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000003720
AA Change: T264A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003720
Gene: ENSMUSG00000003623
AA Change: T264A

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 20 604 2.3e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146115
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein converts 4,8-dimethylnonanoyl-CoA to its corresponding carnitine ester. This transesterification occurs in the peroxisome and is necessary for transport of medium- and long- chain acyl-CoA molecules out of the peroxisome to the cytosol and mitochondria. The protein thus plays a role in lipid metabolism and fatty acid beta-oxidation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
4933427D14Rik T C 11: 72,198,741 R106G probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Ddx3y G A Y: 1,267,170 A232V probably damaging Het
Dst T G 1: 34,011,898 V25G probably benign Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Eps8 A T 6: 137,509,155 M453K probably benign Het
Galnt3 T C 2: 66,107,030 D112G possibly damaging Het
Glra4 C T X: 136,762,793 A336T probably damaging Het
Gmppb A G 9: 108,050,139 D95G probably benign Het
Gprc6a T C 10: 51,628,448 Y100C possibly damaging Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Hsd17b3 A T 13: 64,059,486 V247D probably damaging Het
Htr7 T C 19: 36,056,760 D165G probably damaging Het
Igha T C 12: 113,256,352 probably benign Het
Igsf10 A G 3: 59,331,924 C279R probably damaging Het
Irak4 A G 15: 94,554,740 E182G possibly damaging Het
Lipo3 A T 19: 33,558,323 V274E probably damaging Het
Lrpprc A C 17: 84,770,841 probably null Het
Mast1 T C 8: 84,918,764 Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 F2382L probably benign Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Mrgpra3 T A 7: 47,589,666 I171F probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Myh3 C T 11: 67,096,436 Q1371* probably null Het
Nodal T A 10: 61,423,054 V90E probably benign Het
Npas4 A T 19: 4,986,551 H528Q probably benign Het
Nt5dc3 T C 10: 86,824,236 V382A probably damaging Het
Pcdh18 G A 3: 49,754,586 T293I probably damaging Het
Phf20l1 A G 15: 66,641,816 D947G probably damaging Het
Pla2r1 A G 2: 60,448,962 V758A probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Prkd3 G A 17: 78,959,141 probably benign Het
Prrc2a A G 17: 35,157,932 L734P probably damaging Het
Rnf128 C A X: 139,664,522 L282I probably damaging Het
Rnf213 A G 11: 119,469,053 N4424S probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Setd3 T C 12: 108,165,158 K3R possibly damaging Het
Slc2a7 A G 4: 150,158,210 probably null Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Spc25 A G 2: 69,202,601 L60P probably damaging Het
Stam A C 2: 14,138,961 H354P probably damaging Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tmem120a C G 5: 135,736,277 R254P probably benign Het
Traf5 T C 1: 191,997,876 T405A probably benign Het
Trav7-4 A G 14: 53,461,662 S89G probably benign Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Vip T A 10: 5,642,590 S77T possibly damaging Het
Wdr72 A T 9: 74,218,697 M1025L probably benign Het
Zfp541 A G 7: 16,072,222 D94G probably damaging Het
Other mutations in Crot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Crot APN 5 8976072 missense probably damaging 1.00
IGL01013:Crot APN 5 8993575 missense probably benign 0.06
IGL01085:Crot APN 5 8973955 missense probably damaging 1.00
IGL02017:Crot APN 5 8970046 splice site probably benign
IGL02306:Crot APN 5 8968701 missense possibly damaging 0.94
IGL02612:Crot APN 5 8969945 missense probably damaging 1.00
IGL02884:Crot APN 5 8978197 critical splice donor site probably null
IGL03091:Crot APN 5 8966897 missense probably benign
IGL03356:Crot APN 5 8988295 splice site probably benign
ouray UTSW 5 8993504 critical splice donor site probably null
R0383:Crot UTSW 5 8968734 missense probably damaging 1.00
R0396:Crot UTSW 5 8969959 missense probably damaging 1.00
R0502:Crot UTSW 5 8976075 missense possibly damaging 0.66
R0503:Crot UTSW 5 8976075 missense possibly damaging 0.66
R0676:Crot UTSW 5 8993622 utr 5 prime probably benign
R1079:Crot UTSW 5 8993504 critical splice donor site probably null
R1472:Crot UTSW 5 8966941 missense probably damaging 1.00
R1595:Crot UTSW 5 8974186 missense probably benign 0.00
R1757:Crot UTSW 5 8987828 missense probably damaging 1.00
R1828:Crot UTSW 5 8969080 missense probably benign 0.01
R1846:Crot UTSW 5 8988248 missense probably benign 0.36
R2142:Crot UTSW 5 8987780 missense possibly damaging 0.94
R3974:Crot UTSW 5 8977541 missense probably benign
R3975:Crot UTSW 5 8977541 missense probably benign
R4445:Crot UTSW 5 8973643 missense probably damaging 1.00
R4446:Crot UTSW 5 8973643 missense probably damaging 1.00
R4995:Crot UTSW 5 8974000 missense probably damaging 1.00
R5084:Crot UTSW 5 8969994 missense probably damaging 1.00
R5464:Crot UTSW 5 8983690 splice site probably null
R5673:Crot UTSW 5 8988131 missense probably benign 0.00
R5814:Crot UTSW 5 8973996 missense probably damaging 0.99
R5935:Crot UTSW 5 8974192 missense probably benign
R5951:Crot UTSW 5 8969120 nonsense probably null
R6862:Crot UTSW 5 8989641 missense probably damaging 0.99
R6885:Crot UTSW 5 8973635 missense probably benign 0.00
R6983:Crot UTSW 5 8978280 missense probably benign 0.06
R7150:Crot UTSW 5 8987878 missense probably damaging 0.99
R7228:Crot UTSW 5 8976051 missense probably damaging 1.00
R7361:Crot UTSW 5 8977534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTACACAATATAGTTCATAGGTGA -3'
(R):5'- ACTCGGTGGGCAAAGGTAATAA -3'

Sequencing Primer
(F):5'- TAGGTGAGAAAAATTCTAAGACCCTG -3'
(R):5'- TCCCAGAAGCTGTCGTGTGAATAG -3'
Posted On2015-04-30