Incidental Mutation 'R4026:Srsf6'
ID312976
Institutional Source Beutler Lab
Gene Symbol Srsf6
Ensembl Gene ENSMUSG00000016921
Gene Nameserine/arginine-rich splicing factor 6
SynonymsSfrs6, 1210001E11Rik
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.756) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location162931528-162937121 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 162934291 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017065] [ENSMUST00000126163] [ENSMUST00000130411]
Predicted Effect probably benign
Transcript: ENSMUST00000017065
SMART Domains Protein: ENSMUSP00000142183
Gene: ENSMUSG00000016921

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126163
SMART Domains Protein: ENSMUSP00000141349
Gene: ENSMUSG00000016921

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000130411
AA Change: S218R
SMART Domains Protein: ENSMUSP00000119065
Gene: ENSMUSG00000016921
AA Change: S218R

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
low complexity region 74 100 N/A INTRINSIC
RRM 111 179 6.97e-14 SMART
low complexity region 184 280 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 313 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193611
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Srsf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Srsf6 APN 2 162931707 missense probably damaging 1.00
IGL01960:Srsf6 APN 2 162933754 missense probably damaging 1.00
R1292:Srsf6 UTSW 2 162934483 unclassified probably benign
R1789:Srsf6 UTSW 2 162934488 unclassified probably benign
R1936:Srsf6 UTSW 2 162934483 unclassified probably benign
R1937:Srsf6 UTSW 2 162934483 unclassified probably benign
R1939:Srsf6 UTSW 2 162934483 unclassified probably benign
R1940:Srsf6 UTSW 2 162934483 unclassified probably benign
R2225:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R2226:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R2227:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R4290:Srsf6 UTSW 2 162934716 unclassified probably benign
R4292:Srsf6 UTSW 2 162934716 unclassified probably benign
R4293:Srsf6 UTSW 2 162934716 unclassified probably benign
R4294:Srsf6 UTSW 2 162934716 unclassified probably benign
R4295:Srsf6 UTSW 2 162934716 unclassified probably benign
R4592:Srsf6 UTSW 2 162931723 missense probably damaging 0.99
R4613:Srsf6 UTSW 2 162933709 missense probably benign 0.45
R4657:Srsf6 UTSW 2 162933427 missense probably benign 0.01
R7378:Srsf6 UTSW 2 162934569 missense unknown
R7446:Srsf6 UTSW 2 162934716 missense unknown
X0020:Srsf6 UTSW 2 162933498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCAGATATTCTAGCCACAGATG -3'
(R):5'- ATTTCCTGCCTTTTGAGCGG -3'

Sequencing Primer
(F):5'- GGATTTGAACTCAGGACCTTCAG -3'
(R):5'- TGAGCGGGATCGGGATC -3'
Posted On2015-04-30