Incidental Mutation 'R4026:Vmn1r34'
ID312982
Institutional Source Beutler Lab
Gene Symbol Vmn1r34
Ensembl Gene ENSMUSG00000091012
Gene Namevomeronasal 1 receptor 34
SynonymsGm5991
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location66635936-66643879 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66637704 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 17 (M17L)
Ref Sequence ENSEMBL: ENSMUSP00000153720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074381] [ENSMUST00000226262] [ENSMUST00000226910] [ENSMUST00000226999] [ENSMUST00000227332] [ENSMUST00000228498] [ENSMUST00000228647]
Predicted Effect probably benign
Transcript: ENSMUST00000074381
AA Change: M17L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132900
Gene: ENSMUSG00000091012
AA Change: M17L

DomainStartEndE-ValueType
Pfam:V1R 28 293 2.2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226262
AA Change: M17L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000226910
AA Change: M17L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000226999
AA Change: M17L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227332
AA Change: M17L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228498
AA Change: M17L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228647
AA Change: M17L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Vmn1r34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Vmn1r34 APN 6 66637655 missense possibly damaging 0.64
IGL01322:Vmn1r34 APN 6 66636915 nonsense probably null
IGL01866:Vmn1r34 APN 6 66637389 missense probably benign 0.03
IGL02389:Vmn1r34 APN 6 66637058 missense probably damaging 1.00
IGL03356:Vmn1r34 APN 6 66636986 missense probably benign 0.00
R0508:Vmn1r34 UTSW 6 66637408 missense probably benign 0.19
R0601:Vmn1r34 UTSW 6 66637664 missense possibly damaging 0.94
R1381:Vmn1r34 UTSW 6 66636938 missense probably damaging 1.00
R1605:Vmn1r34 UTSW 6 66636948 missense probably benign 0.01
R1765:Vmn1r34 UTSW 6 66637496 missense probably damaging 0.99
R2022:Vmn1r34 UTSW 6 66637401 missense possibly damaging 0.90
R3878:Vmn1r34 UTSW 6 66637568 missense possibly damaging 0.82
R4023:Vmn1r34 UTSW 6 66637704 missense probably benign
R4024:Vmn1r34 UTSW 6 66637704 missense probably benign
R4025:Vmn1r34 UTSW 6 66637704 missense probably benign
R4385:Vmn1r34 UTSW 6 66637139 missense probably damaging 0.99
R5274:Vmn1r34 UTSW 6 66637139 missense probably damaging 1.00
R6182:Vmn1r34 UTSW 6 66637328 missense probably damaging 0.97
R6629:Vmn1r34 UTSW 6 66637515 missense probably benign 0.00
R7143:Vmn1r34 UTSW 6 66637664 missense probably benign 0.12
X0066:Vmn1r34 UTSW 6 66637475 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTCATTGACAATGTTCAATGACCC -3'
(R):5'- GGCTCAGATGTAATACAGGCACAC -3'

Sequencing Primer
(F):5'- TGACCCAAGTAAATCTGTAAGCC -3'
(R):5'- GCTAATCGATGCCTCAATGTAGG -3'
Posted On2015-04-30