Incidental Mutation 'R4026:Tas2r105'
ID312985
Institutional Source Beutler Lab
Gene Symbol Tas2r105
Ensembl Gene ENSMUSG00000051153
Gene Nametaste receptor, type 2, member 105
SynonymsT2r5, Tas2r5, T2R05, T2R9, mGR05, mt2r5
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location131686532-131687495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131686826 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 213 (V213A)
Ref Sequence ENSEMBL: ENSMUSP00000058006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]
Predicted Effect probably benign
Transcript: ENSMUST00000053652
AA Change: V213A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153
AA Change: V213A

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 9.4e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072404
SMART Domains Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.3e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080619
SMART Domains Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.1e-104 PFAM
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation respond normally to a variety of bitter, sweet, umami, salty and sour stimuli but show a striking and selective impairement in their ability to taste cycloheximide (a bitter tastant). In addition, homozygotes are no longer behaviorally averse to cycloheximide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Tas2r105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Tas2r105 APN 6 131687111 missense probably benign 0.02
IGL01148:Tas2r105 APN 6 131686852 missense probably damaging 1.00
IGL02882:Tas2r105 APN 6 131687180 missense possibly damaging 0.95
R0833:Tas2r105 UTSW 6 131687430 missense probably benign 0.01
R0836:Tas2r105 UTSW 6 131687430 missense probably benign 0.01
R1429:Tas2r105 UTSW 6 131686941 missense probably benign 0.01
R2010:Tas2r105 UTSW 6 131687402 missense probably benign 0.41
R2418:Tas2r105 UTSW 6 131687447 missense probably damaging 1.00
R4023:Tas2r105 UTSW 6 131686826 missense probably benign 0.02
R4742:Tas2r105 UTSW 6 131686851 missense probably damaging 1.00
R5497:Tas2r105 UTSW 6 131686842 unclassified probably null
R5812:Tas2r105 UTSW 6 131686873 missense possibly damaging 0.95
R7191:Tas2r105 UTSW 6 131686982 missense probably damaging 0.99
R7236:Tas2r105 UTSW 6 131686760 missense probably damaging 1.00
R7482:Tas2r105 UTSW 6 131687009 missense probably benign 0.10
X0067:Tas2r105 UTSW 6 131687270 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AAGGCTTGCTTTAGCTGGC -3'
(R):5'- AAGTGAATCATAGAAACAGGACCTC -3'

Sequencing Primer
(F):5'- CAGCAAGGATATATGGATGCAGTTG -3'
(R):5'- ACCTCGGAGATGTACTGGG -3'
Posted On2015-04-30