Incidental Mutation 'R4026:Mrpl3'
ID312991
Institutional Source Beutler Lab
Gene Symbol Mrpl3
Ensembl Gene ENSMUSG00000032563
Gene Namemitochondrial ribosomal protein L3
Synonyms2010320L16Rik, 5930422H18Rik
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105053239-105079888 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 105071486 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035177] [ENSMUST00000035177] [ENSMUST00000142424] [ENSMUST00000142424] [ENSMUST00000149243] [ENSMUST00000149243]
Predicted Effect probably null
Transcript: ENSMUST00000035177
SMART Domains Protein: ENSMUSP00000035177
Gene: ENSMUSG00000032563

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 119 1.1e-13 PFAM
Pfam:Ribosomal_L3 112 340 2e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000035177
SMART Domains Protein: ENSMUSP00000035177
Gene: ENSMUSG00000032563

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 119 1.1e-13 PFAM
Pfam:Ribosomal_L3 112 340 2e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139022
Predicted Effect probably benign
Transcript: ENSMUST00000142424
Predicted Effect probably benign
Transcript: ENSMUST00000142424
Predicted Effect probably null
Transcript: ENSMUST00000149243
SMART Domains Protein: ENSMUSP00000117547
Gene: ENSMUSG00000032563

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 103 300 1.4e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149243
SMART Domains Protein: ENSMUSP00000117547
Gene: ENSMUSG00000032563

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 103 300 1.4e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215577
Meta Mutation Damage Score 0.488 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the L3P ribosomal protein family. A pseudogene corresponding to this gene is found on chromosome 13q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Mrpl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Mrpl3 APN 9 105064106 missense probably damaging 1.00
IGL00917:Mrpl3 APN 9 105057041 missense probably damaging 1.00
IGL01989:Mrpl3 APN 9 105071479 missense probably benign 0.39
IGL02727:Mrpl3 APN 9 105054527 missense probably damaging 0.99
IGL03188:Mrpl3 APN 9 105057065 missense probably benign 0.00
R0049:Mrpl3 UTSW 9 105055673 missense probably benign 0.06
R0049:Mrpl3 UTSW 9 105055673 missense probably benign 0.06
R0398:Mrpl3 UTSW 9 105064103 missense probably damaging 1.00
R1469:Mrpl3 UTSW 9 105077002 missense probably damaging 0.99
R1469:Mrpl3 UTSW 9 105077002 missense probably damaging 0.99
R1784:Mrpl3 UTSW 9 105057067 missense probably benign 0.00
R4812:Mrpl3 UTSW 9 105073824 missense probably damaging 1.00
R4838:Mrpl3 UTSW 9 105057032 missense probably damaging 1.00
R5407:Mrpl3 UTSW 9 105077095 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TACAGAGCTAGGTTCCAGCG -3'
(R):5'- CCACAGGTACTCATGCACTAG -3'

Sequencing Primer
(F):5'- GACTTGTTAGAACTCCAAAGTGC -3'
(R):5'- TACTCATGCACTAGAAAAATGGGTG -3'
Posted On2015-04-30