Incidental Mutation 'R4026:Zfyve1'
ID312996
Institutional Source Beutler Lab
Gene Symbol Zfyve1
Ensembl Gene ENSMUSG00000042628
Gene Namezinc finger, FYVE domain containing 1
Synonyms
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location83546558-83597222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83594522 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 120 (V120A)
Ref Sequence ENSEMBL: ENSMUSP00000152501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048319] [ENSMUST00000221919]
Predicted Effect probably benign
Transcript: ENSMUST00000048319
AA Change: V120A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042224
Gene: ENSMUSG00000042628
AA Change: V120A

DomainStartEndE-ValueType
low complexity region 429 436 N/A INTRINSIC
FYVE 590 660 8.36e-13 SMART
FYVE 707 776 1.15e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221919
AA Change: V120A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223380
Meta Mutation Damage Score 0.016 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The FYVE domain mediates the recruitment of proteins involved in membrane trafficking and cell signaling to phosphatidylinositol 3-phosphate-containing membranes. This protein contains two zinc-binding FYVE domains in tandem and is reported to localize to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Other mutations in Zfyve1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Zfyve1 APN 12 83574798 missense probably benign 0.09
IGL00475:Zfyve1 APN 12 83555711 critical splice acceptor site probably null
IGL01291:Zfyve1 APN 12 83555005 missense probably benign 0.04
IGL01380:Zfyve1 APN 12 83552507 missense probably damaging 1.00
IGL02037:Zfyve1 APN 12 83547920 missense probably damaging 1.00
IGL02184:Zfyve1 APN 12 83558693 missense probably benign 0.29
IGL02619:Zfyve1 APN 12 83550944 unclassified probably benign
IGL03031:Zfyve1 APN 12 83574821 missense probably damaging 0.99
IGL03105:Zfyve1 APN 12 83558639 missense probably damaging 1.00
sasso UTSW 12 83575056 missense probably damaging 1.00
ANU05:Zfyve1 UTSW 12 83555005 missense probably benign 0.04
R0123:Zfyve1 UTSW 12 83555073 splice site probably benign
R0225:Zfyve1 UTSW 12 83555073 splice site probably benign
R0468:Zfyve1 UTSW 12 83555274 splice site probably benign
R1218:Zfyve1 UTSW 12 83548051 missense possibly damaging 0.79
R1896:Zfyve1 UTSW 12 83555614 missense probably damaging 0.99
R2291:Zfyve1 UTSW 12 83547931 missense probably damaging 0.99
R4023:Zfyve1 UTSW 12 83594522 missense probably benign
R4209:Zfyve1 UTSW 12 83575135 missense probably damaging 1.00
R4211:Zfyve1 UTSW 12 83575135 missense probably damaging 1.00
R4780:Zfyve1 UTSW 12 83558647 missense probably damaging 1.00
R4907:Zfyve1 UTSW 12 83574872 missense probably damaging 0.96
R4908:Zfyve1 UTSW 12 83551571 missense probably damaging 1.00
R4998:Zfyve1 UTSW 12 83548065 missense possibly damaging 0.69
R5076:Zfyve1 UTSW 12 83555647 missense probably damaging 1.00
R5303:Zfyve1 UTSW 12 83575056 missense probably damaging 1.00
R5628:Zfyve1 UTSW 12 83574889 missense probably benign 0.00
R5739:Zfyve1 UTSW 12 83575136 missense possibly damaging 0.61
R6007:Zfyve1 UTSW 12 83558704 missense probably damaging 1.00
R6355:Zfyve1 UTSW 12 83594641 missense probably benign 0.01
R6641:Zfyve1 UTSW 12 83594496 missense probably benign
R6735:Zfyve1 UTSW 12 83594844 missense possibly damaging 0.90
R7222:Zfyve1 UTSW 12 83555005 missense probably benign
R7278:Zfyve1 UTSW 12 83551540 missense probably damaging 1.00
R7464:Zfyve1 UTSW 12 83551487 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTTCTGCCTCTAAGGGGC -3'
(R):5'- GACTCAAAGCTGGCCATGTC -3'

Sequencing Primer
(F):5'- TTGCAGAGCAAGTTCCCAG -3'
(R):5'- AAAGCTGGCCATGTCCCTTATTG -3'
Posted On2015-04-30