Incidental Mutation 'R4026:Sidt1'
ID313002
Institutional Source Beutler Lab
Gene Symbol Sidt1
Ensembl Gene ENSMUSG00000022696
Gene NameSID1 transmembrane family, member 1
SynonymsB830021E24Rik
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44240180-44333196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44281886 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 304 (S304P)
Ref Sequence ENSEMBL: ENSMUSP00000115372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047446] [ENSMUST00000136381]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047446
AA Change: S304P

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038433
Gene: ENSMUSG00000022696
AA Change: S304P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
Pfam:SID-1_RNA_chan 184 832 1.8e-290 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127124
Predicted Effect possibly damaging
Transcript: ENSMUST00000136381
AA Change: S304P

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115372
Gene: ENSMUSG00000022696
AA Change: S304P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
Pfam:SID-1_RNA_chan 184 827 1.3e-251 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000147032
AA Change: S16P
SMART Domains Protein: ENSMUSP00000114424
Gene: ENSMUSG00000022696
AA Change: S16P

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Sidt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Sidt1 APN 16 44262011 splice site probably benign
IGL01103:Sidt1 APN 16 44243543 nonsense probably null
IGL01725:Sidt1 APN 16 44284282 missense probably benign 0.06
IGL02000:Sidt1 APN 16 44286369 missense probably damaging 0.98
IGL02266:Sidt1 APN 16 44254985 missense possibly damaging 0.90
IGL02309:Sidt1 APN 16 44254980 missense probably benign 0.00
IGL02898:Sidt1 APN 16 44282495 missense possibly damaging 0.87
R0282:Sidt1 UTSW 16 44281886 missense possibly damaging 0.79
R0525:Sidt1 UTSW 16 44259446 missense possibly damaging 0.64
R0927:Sidt1 UTSW 16 44243532 missense probably benign 0.00
R1806:Sidt1 UTSW 16 44281871 missense possibly damaging 0.46
R1911:Sidt1 UTSW 16 44281871 missense possibly damaging 0.81
R3843:Sidt1 UTSW 16 44284224 missense probably benign 0.04
R3848:Sidt1 UTSW 16 44255959 intron probably benign
R4023:Sidt1 UTSW 16 44281886 missense possibly damaging 0.79
R4495:Sidt1 UTSW 16 44282478 missense probably damaging 1.00
R4603:Sidt1 UTSW 16 44255026 missense probably damaging 0.98
R4707:Sidt1 UTSW 16 44269858 nonsense probably null
R5322:Sidt1 UTSW 16 44281622 intron probably benign
R5921:Sidt1 UTSW 16 44273735 splice site probably benign
R5980:Sidt1 UTSW 16 44263312 nonsense probably null
R5982:Sidt1 UTSW 16 44261708 missense probably damaging 1.00
R6063:Sidt1 UTSW 16 44259466 missense probably benign 0.01
R6337:Sidt1 UTSW 16 44300935 splice site probably null
R6392:Sidt1 UTSW 16 44291294 missense possibly damaging 0.47
R6855:Sidt1 UTSW 16 44245343 missense probably null 1.00
R7092:Sidt1 UTSW 16 44299829 missense possibly damaging 0.89
R7099:Sidt1 UTSW 16 44243497 missense probably damaging 1.00
R7448:Sidt1 UTSW 16 44286400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAAGCAGTTTGCCCAAGAC -3'
(R):5'- TTTTCAGGTCGTCACTACAAAGC -3'

Sequencing Primer
(F):5'- CACACTTAGTGGGCCAGTCAG -3'
(R):5'- CGTCACTACAAAGCTACTTGTGGG -3'
Posted On2015-04-30