Incidental Mutation 'R0386:Ofcc1'
ID31306
Institutional Source Beutler Lab
Gene Symbol Ofcc1
Ensembl Gene ENSMUSG00000047094
Gene Nameorofacial cleft 1 candidate 1
SynonymsOpo, ojoplano
MMRRC Submission 038592-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0386 (G1)
Quality Score207
Status Validated
Chromosome13
Chromosomal Location40001882-40361450 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 40214474 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 188 (L188*)
Ref Sequence ENSEMBL: ENSMUSP00000062217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054635] [ENSMUST00000224909]
Predicted Effect probably null
Transcript: ENSMUST00000054635
AA Change: L188*
SMART Domains Protein: ENSMUSP00000062217
Gene: ENSMUSG00000047094
AA Change: L188*

DomainStartEndE-ValueType
Pfam:OFCC1 5 113 1.3e-57 PFAM
transmembrane domain 575 592 N/A INTRINSIC
transmembrane domain 599 618 N/A INTRINSIC
transmembrane domain 633 655 N/A INTRINSIC
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224909
Meta Mutation Damage Score 0.5868 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal skull morphology and normal behavior with in increase in gamma-glutamyl transpeptidase. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,461 V194A probably damaging Het
Adamts13 G A 2: 26,986,679 probably null Het
Ahnak T C 19: 9,011,144 M3264T possibly damaging Het
Birc6 T A 17: 74,599,340 C1409S probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Dnah2 A G 11: 69,447,861 V3161A probably damaging Het
Dnah5 A T 15: 28,383,581 Y2983F probably damaging Het
Dnah6 G A 6: 73,083,124 L2774F probably damaging Het
Dst A T 1: 34,217,836 T4398S probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Efcab5 A T 11: 77,172,378 M96K probably benign Het
Elavl4 A G 4: 110,206,705 probably benign Het
Flt4 G A 11: 49,644,386 A1214T probably benign Het
Fn1 G T 1: 71,595,786 T2127N probably damaging Het
Foxj1 A T 11: 116,331,803 S391R possibly damaging Het
Gabrb1 A T 5: 72,108,807 Y269F probably damaging Het
Ghitm A G 14: 37,125,911 S259P possibly damaging Het
Gm16332 A G 1: 139,924,190 noncoding transcript Het
Gm16380 T A 9: 53,884,443 noncoding transcript Het
Gm9869 A T 9: 60,838,062 probably benign Het
Gm9936 G A 5: 114,857,131 Q142* probably null Het
Hmbs T C 9: 44,337,008 Y260C probably benign Het
Hoxc5 T A 15: 103,015,352 C193* probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Lce1j T C 3: 92,789,388 K28E unknown Het
Lpgat1 C T 1: 191,719,348 probably benign Het
Lyst T C 13: 13,708,214 probably benign Het
Megf11 A G 9: 64,640,078 N235D probably damaging Het
Mst1r T A 9: 107,916,804 probably null Het
Nr2c2ap A G 8: 70,131,587 D9G probably benign Het
Obscn T C 11: 59,136,339 T13A probably damaging Het
Olfr1028 A G 2: 85,951,873 E270G probably damaging Het
Olfr432 A T 1: 174,050,399 T9S probably benign Het
Oma1 A T 4: 103,325,201 probably benign Het
Pcm1 T C 8: 41,316,023 F1642S probably damaging Het
Pglyrp2 A G 17: 32,420,862 M1T probably null Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm10 C A 9: 31,316,300 T67K probably damaging Het
Ralgapa1 A T 12: 55,708,067 H1193Q probably benign Het
Sall1 A G 8: 89,032,604 S291P probably damaging Het
Sdk2 T C 11: 113,893,464 T150A probably damaging Het
Sel1l2 T A 2: 140,275,441 Y170F probably benign Het
Sema4a C T 3: 88,436,800 V715I possibly damaging Het
Smgc G A 15: 91,854,638 A500T probably benign Het
Spef2 A G 15: 9,584,062 V1639A probably damaging Het
Srrm4 A G 5: 116,482,378 probably benign Het
Tbc1d23 G A 16: 57,189,273 H418Y probably damaging Het
Tbk1 A G 10: 121,584,254 L10P probably damaging Het
Thumpd3 G A 6: 113,065,660 probably null Het
Trp53bp1 G T 2: 121,204,943 T1609K probably damaging Het
Tut1 A G 19: 8,955,555 N84S probably benign Het
Urb1 C T 16: 90,796,399 G282R probably damaging Het
Usp19 A T 9: 108,499,711 D1160V probably damaging Het
Usp9y A G Y: 1,316,933 V1872A probably damaging Het
Zfp276 C A 8: 123,259,503 Y386* probably null Het
Other mutations in Ofcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Ofcc1 APN 13 40142804 missense probably damaging 0.97
IGL00489:Ofcc1 APN 13 40280491 missense probably damaging 1.00
IGL01952:Ofcc1 APN 13 40280861 missense probably damaging 1.00
IGL02126:Ofcc1 APN 13 40208775 missense probably benign
IGL02619:Ofcc1 APN 13 40097077 missense possibly damaging 0.68
IGL03069:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03133:Ofcc1 APN 13 40072768 missense probably benign 0.36
IGL03273:Ofcc1 APN 13 40180525 missense probably damaging 1.00
IGL03343:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03349:Ofcc1 APN 13 40072752 missense probably benign 0.13
IGL03399:Ofcc1 APN 13 40142838 missense possibly damaging 0.56
LCD18:Ofcc1 UTSW 13 40092967 intron probably benign
R0122:Ofcc1 UTSW 13 40280556 splice site probably null
R0320:Ofcc1 UTSW 13 40206696 missense probably benign 0.01
R0390:Ofcc1 UTSW 13 40015313 missense possibly damaging 0.85
R0829:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0866:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0945:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0981:Ofcc1 UTSW 13 40072698 missense probably damaging 1.00
R1055:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1056:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1186:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1187:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1400:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1411:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R1419:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1474:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1636:Ofcc1 UTSW 13 40180428 missense possibly damaging 0.86
R1691:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1886:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R1887:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R2176:Ofcc1 UTSW 13 40097119 missense probably benign
R2189:Ofcc1 UTSW 13 40180448 missense probably benign
R2242:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R2255:Ofcc1 UTSW 13 40094705 missense probably damaging 0.99
R2471:Ofcc1 UTSW 13 40097025 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40072760 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40087938 missense possibly damaging 0.56
R4366:Ofcc1 UTSW 13 40015461 missense probably benign 0.18
R4573:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4574:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4656:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4657:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4673:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4782:Ofcc1 UTSW 13 40001892 synonymous probably null
R4790:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4823:Ofcc1 UTSW 13 40280473 missense probably damaging 0.99
R4834:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4840:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4842:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4889:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4919:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4920:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4921:Ofcc1 UTSW 13 40214517 missense probably benign 0.10
R4948:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4953:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4961:Ofcc1 UTSW 13 40263559 critical splice donor site probably null
R5339:Ofcc1 UTSW 13 40087845 missense probably benign 0.35
R5512:Ofcc1 UTSW 13 40206810 missense probably benign 0.20
R5566:Ofcc1 UTSW 13 40094653 missense probably damaging 1.00
R5672:Ofcc1 UTSW 13 40280429 missense probably damaging 0.98
R5734:Ofcc1 UTSW 13 40087849 missense probably damaging 1.00
R5839:Ofcc1 UTSW 13 40280545 missense probably damaging 1.00
R5853:Ofcc1 UTSW 13 40206717 missense probably benign 0.00
R5896:Ofcc1 UTSW 13 40180584 missense probably benign 0.01
R5909:Ofcc1 UTSW 13 40263578 missense possibly damaging 0.92
R5995:Ofcc1 UTSW 13 40280422 missense probably damaging 1.00
R6306:Ofcc1 UTSW 13 40148576 missense probably benign
R6460:Ofcc1 UTSW 13 40287979 missense probably damaging 0.99
R6504:Ofcc1 UTSW 13 40097055 missense probably damaging 1.00
R6797:Ofcc1 UTSW 13 40087947 missense possibly damaging 0.75
R7091:Ofcc1 UTSW 13 40072767 missense probably damaging 0.99
R7098:Ofcc1 UTSW 13 40003966 critical splice donor site probably null
R7142:Ofcc1 UTSW 13 40004062 missense probably benign 0.00
X0005:Ofcc1 UTSW 13 40142790 missense probably benign 0.01
X0005:Ofcc1 UTSW 13 40280532 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCCCTAAAGTCTGGCTCGCTAC -3'
(R):5'- GTGTCTTCCTTGGCAGCAATTATGC -3'

Sequencing Primer
(F):5'- GTCTGGCTCGCTACTTAAAATAAGC -3'
(R):5'- CTTGGCAGCAATTATGCAAGTAAG -3'
Posted On2013-04-24