Incidental Mutation 'R4028:Lefty1'
ID313071
Institutional Source Beutler Lab
Gene Symbol Lefty1
Ensembl Gene ENSMUSG00000038793
Gene Nameleft right determination factor 1
Synonymslefty-1, Lefty, Stra3, Ebaf
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location180935022-180938400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180937781 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 305 (S305P)
Ref Sequence ENSEMBL: ENSMUSP00000041427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027800] [ENSMUST00000037361] [ENSMUST00000159436] [ENSMUST00000161847] [ENSMUST00000162283]
Predicted Effect probably benign
Transcript: ENSMUST00000027800
SMART Domains Protein: ENSMUSP00000027800
Gene: ENSMUSG00000026519

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 213 3.3e-24 PFAM
Pfam:PHM7_cyt 261 327 8.2e-12 PFAM
Pfam:RSN1_7TM 349 692 1.5e-87 PFAM
transmembrane domain 697 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037361
AA Change: S305P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000041427
Gene: ENSMUSG00000038793
AA Change: S305P

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:TGFb_propeptide 19 237 1.6e-13 PFAM
TGFB 265 356 5.78e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132087
Predicted Effect probably benign
Transcript: ENSMUST00000159436
SMART Domains Protein: ENSMUSP00000125192
Gene: ENSMUSG00000026519

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 173 2.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161847
SMART Domains Protein: ENSMUSP00000124937
Gene: ENSMUSG00000026519

DomainStartEndE-ValueType
transmembrane domain 49 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162283
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which plays a role in left-right asymmetry determination of organ systems during development. Mice lacking a functional copy of this gene exhibit embryonic lethality and defects in left-right patterning. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele show embryonic and postnatal lethality, abnormal liver lobation, and a variety of left-right positional defects in visceral organs including left thoracic and atrial isomerism. A subset of mice homozygous for a differentnull allele show left pulmonary isomerism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Lefty1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02445:Lefty1 APN 1 180937677 missense probably benign 0.01
IGL02974:Lefty1 APN 1 180935277 missense probably benign 0.21
R0230:Lefty1 UTSW 1 180937014 missense probably damaging 1.00
R0383:Lefty1 UTSW 1 180937634 nonsense probably null
R1976:Lefty1 UTSW 1 180937824 missense probably benign 0.01
R2351:Lefty1 UTSW 1 180937242 missense possibly damaging 0.80
R4027:Lefty1 UTSW 1 180937781 missense probably benign 0.00
R4029:Lefty1 UTSW 1 180937781 missense probably benign 0.00
R4030:Lefty1 UTSW 1 180937781 missense probably benign 0.00
R4719:Lefty1 UTSW 1 180937712 missense probably benign 0.01
R4761:Lefty1 UTSW 1 180937625 missense probably benign 0.40
R5476:Lefty1 UTSW 1 180937698 missense probably benign 0.06
R6151:Lefty1 UTSW 1 180935116 missense unknown
R6175:Lefty1 UTSW 1 180935149 missense unknown
R6362:Lefty1 UTSW 1 180937160 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TCAAGGCAATTGTGACCCCG -3'
(R):5'- CAGATTTGCATGAAAGGCACATCC -3'

Sequencing Primer
(F):5'- AATTGTGACCCCGAGGCAC -3'
(R):5'- ACATCCTTGGGGAAGCCAC -3'
Posted On2015-04-30