Incidental Mutation 'R4028:Gpatch2'
ID313072
Institutional Source Beutler Lab
Gene Symbol Gpatch2
Ensembl Gene ENSMUSG00000039210
Gene NameG patch domain containing 2
Synonyms5830433G22Rik, Gpatc2, 5830436K05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location187215508-187351704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 187226140 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 231 (S231G)
Ref Sequence ENSEMBL: ENSMUSP00000137858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044812] [ENSMUST00000065573] [ENSMUST00000110943] [ENSMUST00000159748] [ENSMUST00000160471] [ENSMUST00000160481] [ENSMUST00000160570]
Predicted Effect probably benign
Transcript: ENSMUST00000044812
AA Change: S231G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048979
Gene: ENSMUSG00000039210
AA Change: S231G

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065573
AA Change: S231G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000065009
Gene: ENSMUSG00000039210
AA Change: S231G

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
G_patch 464 510 3.95e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097443
SMART Domains Protein: ENSMUSP00000095052
Gene: ENSMUSG00000039210

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110943
AA Change: S231G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106568
Gene: ENSMUSG00000039210
AA Change: S231G

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
G_patch 427 473 3.95e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159748
AA Change: S231G

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137858
Gene: ENSMUSG00000039210
AA Change: S231G

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160471
AA Change: S208G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124407
Gene: ENSMUSG00000039210
AA Change: S208G

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 84 95 N/A INTRINSIC
low complexity region 132 142 N/A INTRINSIC
low complexity region 182 191 N/A INTRINSIC
low complexity region 227 242 N/A INTRINSIC
G_patch 441 487 3.95e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160481
AA Change: S231G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000137801
Gene: ENSMUSG00000039210
AA Change: S231G

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160570
SMART Domains Protein: ENSMUSP00000125750
Gene: ENSMUSG00000039210

DomainStartEndE-ValueType
G_patch 133 179 3.95e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161260
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a nuclear factor that may play a role in spermatogenesis and in tumor growth during breast cancer. The encoded protein contains a G-patch domain with an RNA binding motif. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Gpatch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Gpatch2 APN 1 187230794 missense probably damaging 1.00
IGL02324:Gpatch2 APN 1 187225739 missense probably damaging 1.00
IGL02493:Gpatch2 APN 1 187233128 splice site probably benign
IGL02583:Gpatch2 APN 1 187233317 splice site probably null
IGL02583:Gpatch2 APN 1 187233318 splice site probably null
IGL02632:Gpatch2 APN 1 187225981 missense probably damaging 1.00
R0100:Gpatch2 UTSW 1 187225817 missense probably damaging 1.00
R1801:Gpatch2 UTSW 1 187225831 missense probably benign 0.03
R1966:Gpatch2 UTSW 1 187322301 missense probably damaging 1.00
R3870:Gpatch2 UTSW 1 187322294 missense probably damaging 1.00
R4471:Gpatch2 UTSW 1 187233140 missense probably damaging 1.00
R5346:Gpatch2 UTSW 1 187225868 missense probably benign 0.00
R6338:Gpatch2 UTSW 1 187225514 missense probably damaging 0.99
R6936:Gpatch2 UTSW 1 187233236 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAGCCTTGGGAACAGAACG -3'
(R):5'- TCATGTGGCAACTTCTAACTATCTG -3'

Sequencing Primer
(F):5'- CTTGGGAACAGAACGCTGCG -3'
(R):5'- GGCAACTTCTAACTATCTGAAACAG -3'
Posted On2015-04-30