Incidental Mutation 'R4028:Rcn1'
ID313076
Institutional Source Beutler Lab
Gene Symbol Rcn1
Ensembl Gene ENSMUSG00000005973
Gene Namereticulocalbin 1
SynonymsRcn
Accession Numbers

Ncbi RefSeq: NM_009037.2; MGI:104559

Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location105386291-105399319 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 105399050 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 52 (Y52*)
Ref Sequence ENSEMBL: ENSMUSP00000006128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006128]
Predicted Effect probably null
Transcript: ENSMUST00000006128
AA Change: Y52*
SMART Domains Protein: ENSMUSP00000006128
Gene: ENSMUSG00000005973
AA Change: Y52*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EFh 77 105 1.45e0 SMART
EFh 113 141 6.56e0 SMART
Blast:EFh 164 192 3e-9 BLAST
EFh 201 229 4.35e-2 SMART
Pfam:EF-hand_5 244 267 1.6e-4 PFAM
Blast:EFh 278 306 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127019
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Reticulocalbin 1 is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. High conservation of amino acid residues outside of these motifs, in comparison to mouse reticulocalbin, is consistent with a possible biochemical function besides that of calcium binding. In human endothelial and prostate cancer cell lines this protein localizes to the plasma membrane.[provided by RefSeq, Jan 2009]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Rcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Rcn1 APN 2 105394829 missense possibly damaging 0.83
IGL02347:Rcn1 APN 2 105399126 missense probably benign 0.17
P0031:Rcn1 UTSW 2 105389069 nonsense probably null
R0107:Rcn1 UTSW 2 105394781 missense possibly damaging 0.79
R1510:Rcn1 UTSW 2 105389089 missense probably damaging 1.00
R1699:Rcn1 UTSW 2 105399005 missense probably damaging 1.00
R4027:Rcn1 UTSW 2 105399050 nonsense probably null
R4029:Rcn1 UTSW 2 105399050 nonsense probably null
R4923:Rcn1 UTSW 2 105389173 missense probably benign 0.06
R4956:Rcn1 UTSW 2 105394776 nonsense probably null
R5079:Rcn1 UTSW 2 105399057 missense probably damaging 0.96
R5333:Rcn1 UTSW 2 105389126 missense probably benign 0.00
R5709:Rcn1 UTSW 2 105394783 missense probably damaging 1.00
R6160:Rcn1 UTSW 2 105392017 missense probably damaging 1.00
R6525:Rcn1 UTSW 2 105388975 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGACCAACTGGCGCGATTTC -3'
(R):5'- TTGCAGAGAACCCTCCAGTC -3'

Sequencing Primer
(F):5'- CGATTTCGCTTTCGCTTTGC -3'
(R):5'- CAATGGGCGCGTGAGTG -3'
Posted On2015-04-30