Incidental Mutation 'R4028:Reck'
ID313078
Institutional Source Beutler Lab
Gene Symbol Reck
Ensembl Gene ENSMUSG00000028476
Gene Namereversion-inducing-cysteine-rich protein with kazal motifs
SynonymsSt15
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4028 (G1)
Quality Score187
Status Not validated
Chromosome4
Chromosomal Location43875530-43944806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43922931 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 402 (I402T)
Ref Sequence ENSEMBL: ENSMUSP00000030198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030198]
Predicted Effect probably damaging
Transcript: ENSMUST00000030198
AA Change: I402T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030198
Gene: ENSMUSG00000028476
AA Change: I402T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
KAZAL 632 671 1.18e-2 SMART
KAZAL 708 750 1.46e-2 SMART
KAZAL 753 787 4.26e-2 SMART
low complexity region 877 890 N/A INTRINSIC
low complexity region 927 946 N/A INTRINSIC
low complexity region 950 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128463
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cysteine-rich, extracellular protein with protease inhibitor-like domains whose expression is suppressed strongly in many tumors and cells transformed by various kinds of oncogenes. In normal cells, this membrane-anchored glycoprotein may serve as a negative regulator for matrix metalloproteinase-9, a key enzyme involved in tumor invasion and metastasis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality around E10.5-E11.5, defects in collagen fibrils, basal lamina and vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Reck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Reck APN 4 43940662 missense probably damaging 1.00
IGL01569:Reck APN 4 43925172 missense probably benign 0.00
IGL02341:Reck APN 4 43925160 missense probably damaging 0.97
IGL02637:Reck APN 4 43898009 missense probably damaging 0.97
IGL02709:Reck APN 4 43913791 missense probably damaging 0.99
IGL02829:Reck APN 4 43891014 missense probably damaging 0.96
IGL02928:Reck APN 4 43912078 missense possibly damaging 0.47
IGL03132:Reck APN 4 43938898 nonsense probably null
R0066:Reck UTSW 4 43930936 missense probably damaging 0.97
R0066:Reck UTSW 4 43930936 missense probably damaging 0.97
R0607:Reck UTSW 4 43940719 missense probably benign 0.01
R0626:Reck UTSW 4 43930295 missense probably benign 0.00
R0894:Reck UTSW 4 43922967 missense probably damaging 1.00
R0932:Reck UTSW 4 43922838 missense possibly damaging 0.95
R1564:Reck UTSW 4 43912061 missense probably benign 0.00
R1633:Reck UTSW 4 43922964 missense possibly damaging 0.89
R1772:Reck UTSW 4 43890982 missense probably benign 0.00
R1968:Reck UTSW 4 43913771 splice site probably null
R2105:Reck UTSW 4 43943195 missense probably damaging 0.99
R2225:Reck UTSW 4 43922837 missense probably benign 0.01
R2302:Reck UTSW 4 43931015 missense probably benign 0.28
R2430:Reck UTSW 4 43930202 missense possibly damaging 0.88
R2655:Reck UTSW 4 43938966 missense probably benign 0.01
R3858:Reck UTSW 4 43930261 missense probably benign 0.13
R4027:Reck UTSW 4 43922931 missense probably damaging 1.00
R4029:Reck UTSW 4 43922931 missense probably damaging 1.00
R4080:Reck UTSW 4 43942293 missense possibly damaging 0.95
R4497:Reck UTSW 4 43891001 missense probably benign
R4583:Reck UTSW 4 43931062 critical splice donor site probably null
R4702:Reck UTSW 4 43898060 missense probably damaging 1.00
R5934:Reck UTSW 4 43930979 missense probably damaging 1.00
R6114:Reck UTSW 4 43922895 missense probably damaging 1.00
R6235:Reck UTSW 4 43937450 missense probably damaging 1.00
X0062:Reck UTSW 4 43922921 missense probably damaging 1.00
X0067:Reck UTSW 4 43914016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCTATGGTGGGTCTTATGC -3'
(R):5'- GTTCTAAAGAGAGGCTGGGC -3'

Sequencing Primer
(F):5'- GCGCTCTCTCTTTAAGAAAATCAG -3'
(R):5'- GCTGGGCTAGCGATGAG -3'
Posted On2015-04-30