Incidental Mutation 'R4028:Cyp2j5'
ID313079
Institutional Source Beutler Lab
Gene Symbol Cyp2j5
Ensembl Gene ENSMUSG00000052520
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 5
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.033) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location96628773-96664154 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 96641416 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 239 (Y239*)
Ref Sequence ENSEMBL: ENSMUSP00000030299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030299]
Predicted Effect probably null
Transcript: ENSMUST00000030299
AA Change: Y239*
SMART Domains Protein: ENSMUSP00000030299
Gene: ENSMUSG00000052520
AA Change: Y239*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 497 2.3e-140 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a null mutation display increased systolic blood pressure, increased left ventricular weight, decreased litter sizes, decreased serum estrogen levels, and increased induced vasoconstriction responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Cyp2j5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cyp2j5 APN 4 96630775 missense probably damaging 1.00
IGL00670:Cyp2j5 APN 4 96634275 missense probably benign 0.05
IGL00824:Cyp2j5 APN 4 96663923 missense probably benign
IGL01450:Cyp2j5 APN 4 96658690 missense probably damaging 0.99
IGL01621:Cyp2j5 APN 4 96629554 missense probably benign
IGL02639:Cyp2j5 APN 4 96658749 missense probably benign 0.12
IGL03024:Cyp2j5 APN 4 96629523 missense probably benign 0.03
IGL03212:Cyp2j5 APN 4 96663818 missense probably damaging 0.97
R0112:Cyp2j5 UTSW 4 96629523 missense probably benign 0.03
R0626:Cyp2j5 UTSW 4 96659512 missense probably benign 0.01
R1387:Cyp2j5 UTSW 4 96634285 missense probably damaging 1.00
R1638:Cyp2j5 UTSW 4 96635815 missense probably benign 0.02
R1857:Cyp2j5 UTSW 4 96659486 missense possibly damaging 0.88
R1920:Cyp2j5 UTSW 4 96663254 missense probably damaging 1.00
R2149:Cyp2j5 UTSW 4 96641340 missense possibly damaging 0.95
R2213:Cyp2j5 UTSW 4 96659615 missense probably benign 0.09
R4895:Cyp2j5 UTSW 4 96663110 critical splice donor site probably null
R5132:Cyp2j5 UTSW 4 96629496 missense probably damaging 1.00
R5149:Cyp2j5 UTSW 4 96659507 missense probably damaging 1.00
R5666:Cyp2j5 UTSW 4 96658693 missense probably benign 0.00
R6676:Cyp2j5 UTSW 4 96635808 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- GCCAACGTTTCTGTAAGAAGATG -3'
(R):5'- TGGCATGTACAAGGGAACAATC -3'

Sequencing Primer
(F):5'- CGTTTCTGTAAGAAGATGATACAGG -3'
(R):5'- AGGGATTGGTGACTCAGTATATTTTC -3'
Posted On2015-04-30