Incidental Mutation 'R4028:Oog4'
ID313082
Institutional Source Beutler Lab
Gene Symbol Oog4
Ensembl Gene ENSMUSG00000047799
Gene Nameoogenesin 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143437164-143450324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143440200 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 11 (N11K)
Ref Sequence ENSEMBL: ENSMUSP00000073325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061277] [ENSMUST00000073641]
Predicted Effect probably benign
Transcript: ENSMUST00000061277
SMART Domains Protein: ENSMUSP00000052217
Gene: ENSMUSG00000047799

DomainStartEndE-ValueType
SCOP:d1a4ya_ 195 357 6e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073641
AA Change: N11K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000073325
Gene: ENSMUSG00000047799
AA Change: N11K

DomainStartEndE-ValueType
SCOP:d1a4ya_ 267 429 3e-7 SMART
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Oog4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01580:Oog4 APN 4 143439112 missense probably benign 0.27
IGL02207:Oog4 APN 4 143438940 missense probably benign 0.20
R0038:Oog4 UTSW 4 143438944 missense probably benign 0.20
R0038:Oog4 UTSW 4 143438944 missense probably benign 0.20
R0326:Oog4 UTSW 4 143439203 missense probably benign 0.03
R0372:Oog4 UTSW 4 143437689 missense probably damaging 1.00
R1056:Oog4 UTSW 4 143438011 missense possibly damaging 0.72
R1598:Oog4 UTSW 4 143438001 missense probably damaging 0.99
R1712:Oog4 UTSW 4 143439914 missense probably damaging 1.00
R4029:Oog4 UTSW 4 143440200 missense probably benign 0.02
R4030:Oog4 UTSW 4 143440200 missense probably benign 0.02
R4705:Oog4 UTSW 4 143438875 missense probably benign 0.00
R5260:Oog4 UTSW 4 143437854 missense probably benign 0.00
R5945:Oog4 UTSW 4 143437723 missense probably benign 0.01
R6499:Oog4 UTSW 4 143437978 missense probably damaging 0.96
R6614:Oog4 UTSW 4 143437875 missense possibly damaging 0.66
R6852:Oog4 UTSW 4 143439109 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TATACGTCCACCAATTACGGC -3'
(R):5'- GGCTTTAAAACCAACAAAGGCTG -3'

Sequencing Primer
(F):5'- CGGCTGCTTCAAAAATTGCTG -3'
(R):5'- CAAGCAGGCATCTCTTTGAGGTC -3'
Posted On2015-04-30