Incidental Mutation 'R4028:Gm13101'
ID313083
Institutional Source Beutler Lab
Gene Symbol Gm13101
Ensembl Gene ENSMUSG00000078510
Gene Namepredicted gene 13101
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143964518-143966950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143965784 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 216 (T216S)
Ref Sequence ENSEMBL: ENSMUSP00000101389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105763]
Predicted Effect probably benign
Transcript: ENSMUST00000105763
AA Change: T216S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101389
Gene: ENSMUSG00000078510
AA Change: T216S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 2e-9 SMART
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Gm13101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Gm13101 APN 4 143966614 splice site probably benign
IGL00688:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL00690:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL00693:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL00694:Gm13101 APN 4 143965822 missense possibly damaging 0.62
IGL01412:Gm13101 APN 4 143964995 missense probably damaging 1.00
IGL01781:Gm13101 APN 4 143965729 missense probably benign
IGL02426:Gm13101 APN 4 143966659 missense possibly damaging 0.75
IGL02508:Gm13101 APN 4 143965020 missense probably benign 0.13
IGL03338:Gm13101 APN 4 143965841 missense probably benign 0.01
IGL03338:Gm13101 APN 4 143966038 missense probably benign 0.03
R0201:Gm13101 UTSW 4 143964890 missense probably damaging 1.00
R0325:Gm13101 UTSW 4 143966740 missense probably damaging 1.00
R0538:Gm13101 UTSW 4 143965083 missense possibly damaging 0.76
R1471:Gm13101 UTSW 4 143964953 missense probably benign 0.25
R1544:Gm13101 UTSW 4 143966062 missense probably benign 0.00
R1891:Gm13101 UTSW 4 143966665 missense probably damaging 1.00
R2012:Gm13101 UTSW 4 143966067 missense probably benign 0.00
R2105:Gm13101 UTSW 4 143965820 missense probably benign
R2939:Gm13101 UTSW 4 143966677 missense probably benign 0.00
R2940:Gm13101 UTSW 4 143966677 missense probably benign 0.00
R3723:Gm13101 UTSW 4 143966681 missense probably benign
R3952:Gm13101 UTSW 4 143965786 nonsense probably null
R4029:Gm13101 UTSW 4 143965784 missense probably benign 0.02
R4030:Gm13101 UTSW 4 143965784 missense probably benign 0.02
R5059:Gm13101 UTSW 4 143964995 missense probably damaging 0.99
R5222:Gm13101 UTSW 4 143964792 missense possibly damaging 0.55
R5591:Gm13101 UTSW 4 143964960 missense probably damaging 1.00
R5677:Gm13101 UTSW 4 143965138 missense possibly damaging 0.59
R6021:Gm13101 UTSW 4 143965766 missense probably benign
R6042:Gm13101 UTSW 4 143966061 missense probably benign 0.04
R6155:Gm13101 UTSW 4 143965142 missense probably benign 0.00
R6604:Gm13101 UTSW 4 143965997 missense probably benign 0.02
R6807:Gm13101 UTSW 4 143965011 missense probably damaging 1.00
Z1088:Gm13101 UTSW 4 143965562 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGAGATGCTGGAGACTGTTG -3'
(R):5'- CTAAGGAGACGTTTAAAGGTGGTC -3'

Sequencing Primer
(F):5'- AGACTGTTGAGTTTGGGGAAC -3'
(R):5'- ACGTTTAAAGGTGGTCACTGAC -3'
Posted On2015-04-30