Incidental Mutation 'R4028:Slc7a1'
ID313084
Institutional Source Beutler Lab
Gene Symbol Slc7a1
Ensembl Gene ENSMUSG00000041313
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 1
SynonymsRev-1, Rec-1, Atrc1, Cat1, mCAT-1, 4831426K01Rik, Atrc-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location148327410-148399904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 148345812 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 75 (C75F)
Ref Sequence ENSEMBL: ENSMUSP00000144000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048116] [ENSMUST00000138257] [ENSMUST00000202457]
Predicted Effect probably benign
Transcript: ENSMUST00000048116
AA Change: C226F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046714
Gene: ENSMUSG00000041313
AA Change: C226F

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 440 1.3e-51 PFAM
Pfam:AA_permease 36 431 1.3e-42 PFAM
transmembrane domain 487 509 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Pfam:AA_permease_C 551 601 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138257
AA Change: C226F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117781
Gene: ENSMUSG00000041313
AA Change: C226F

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 439 6e-52 PFAM
Pfam:AA_permease 36 433 2.3e-43 PFAM
transmembrane domain 487 509 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201860
Predicted Effect probably benign
Transcript: ENSMUST00000202457
AA Change: C75F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144000
Gene: ENSMUSG00000041313
AA Change: C75F

DomainStartEndE-ValueType
Pfam:AA_permease 6 142 7.5e-14 PFAM
Pfam:AA_permease_2 11 142 2.7e-16 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants die on the first day of birth and are very anemic. Peripheral blood contains 50% fewer red blood cells, reduced hemoglobin levels, and a defect in erythroid maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Slc7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc7a1 APN 5 148337192 missense possibly damaging 0.61
H8441:Slc7a1 UTSW 5 148334545 missense probably benign 0.17
R0016:Slc7a1 UTSW 5 148334583 missense probably benign 0.04
R0028:Slc7a1 UTSW 5 148335511 missense probably benign 0.00
R0103:Slc7a1 UTSW 5 148352426 nonsense probably null
R0103:Slc7a1 UTSW 5 148352426 nonsense probably null
R0565:Slc7a1 UTSW 5 148352069 missense probably damaging 1.00
R0696:Slc7a1 UTSW 5 148340556 missense probably benign 0.11
R1338:Slc7a1 UTSW 5 148345936 missense probably damaging 1.00
R1539:Slc7a1 UTSW 5 148335593 missense possibly damaging 0.95
R1926:Slc7a1 UTSW 5 148348303 missense probably damaging 1.00
R2895:Slc7a1 UTSW 5 148340592 missense probably benign 0.06
R2910:Slc7a1 UTSW 5 148352257 missense probably benign 0.00
R3721:Slc7a1 UTSW 5 148335533 nonsense probably null
R3722:Slc7a1 UTSW 5 148335533 nonsense probably null
R4114:Slc7a1 UTSW 5 148342057 missense probably damaging 1.00
R4510:Slc7a1 UTSW 5 148340562 missense probably damaging 1.00
R4511:Slc7a1 UTSW 5 148340562 missense probably damaging 1.00
R4600:Slc7a1 UTSW 5 148342059 missense probably damaging 1.00
R4657:Slc7a1 UTSW 5 148352399 missense probably benign
R4723:Slc7a1 UTSW 5 148335440 missense probably damaging 0.99
R5248:Slc7a1 UTSW 5 148333988 missense possibly damaging 0.91
R5697:Slc7a1 UTSW 5 148333982 missense probably benign 0.00
R6027:Slc7a1 UTSW 5 148333964 missense possibly damaging 0.94
R6370:Slc7a1 UTSW 5 148340673 missense probably damaging 1.00
R6847:Slc7a1 UTSW 5 148334658 missense probably benign
V1024:Slc7a1 UTSW 5 148334545 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGCTGCAGGAGAATGTCGTG -3'
(R):5'- TAAACTGGTAAGTGGCTGACC -3'

Sequencing Primer
(F):5'- AAACTCTTTAGCTACTTCACCAGGGG -3'
(R):5'- ATCTACATGGTTTTCTGTTTGTGCC -3'
Posted On2015-04-30