Incidental Mutation 'R4028:Dync1i1'
ID313085
Institutional Source Beutler Lab
Gene Symbol Dync1i1
Ensembl Gene ENSMUSG00000029757
Gene Namedynein cytoplasmic 1 intermediate chain 1
SynonymsIC74, Dncic1, DIC
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.537) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location5725639-6028039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5961842 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 341 (S341F)
Ref Sequence ENSEMBL: ENSMUSP00000111217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115554] [ENSMUST00000115555] [ENSMUST00000115556] [ENSMUST00000115559]
Predicted Effect probably damaging
Transcript: ENSMUST00000115554
AA Change: S304F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111216
Gene: ENSMUSG00000029757
AA Change: S304F

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:Dynein_IC2 105 137 3.1e-20 PFAM
low complexity region 143 150 N/A INTRINSIC
Blast:WD40 235 288 2e-26 BLAST
WD40 293 332 9.6e-2 SMART
WD40 339 382 8.91e-1 SMART
WD40 436 481 4.48e-2 SMART
WD40 484 524 6.19e-1 SMART
WD40 529 569 7.67e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115555
AA Change: S341F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111217
Gene: ENSMUSG00000029757
AA Change: S341F

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
Pfam:Dynein_IC2 143 173 6.9e-18 PFAM
low complexity region 180 187 N/A INTRINSIC
Blast:WD40 272 325 4e-26 BLAST
WD40 330 369 9.6e-2 SMART
WD40 376 419 8.91e-1 SMART
WD40 473 518 4.48e-2 SMART
WD40 521 561 6.19e-1 SMART
WD40 566 606 7.67e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115556
AA Change: S313F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111218
Gene: ENSMUSG00000029757
AA Change: S313F

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
Pfam:Dynein_IC2 114 146 9.2e-21 PFAM
low complexity region 152 159 N/A INTRINSIC
Blast:WD40 245 297 3e-26 BLAST
WD40 302 341 9.6e-2 SMART
WD40 348 391 8.91e-1 SMART
WD40 445 490 4.48e-2 SMART
WD40 493 533 6.19e-1 SMART
WD40 538 578 7.67e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115559
AA Change: S324F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111221
Gene: ENSMUSG00000029757
AA Change: S324F

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:Dynein_IC2 125 157 2e-20 PFAM
low complexity region 163 170 N/A INTRINSIC
Blast:WD40 256 308 3e-26 BLAST
WD40 313 352 9.6e-2 SMART
WD40 359 402 8.91e-1 SMART
WD40 456 501 4.48e-2 SMART
WD40 504 544 6.19e-1 SMART
WD40 549 589 7.67e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130004
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Dync1i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Dync1i1 APN 6 5972135 missense probably damaging 1.00
IGL01816:Dync1i1 APN 6 5767146 critical splice donor site probably null
IGL02171:Dync1i1 APN 6 5969498 missense probably damaging 0.98
IGL02646:Dync1i1 APN 6 5767034 missense probably benign 0.12
IGL02672:Dync1i1 APN 6 5767034 missense probably benign 0.12
IGL02691:Dync1i1 APN 6 5800767 splice site probably benign
IGL02880:Dync1i1 APN 6 5966821 splice site probably null
IGL02796:Dync1i1 UTSW 6 5757385 missense probably benign 0.00
R0519:Dync1i1 UTSW 6 6027399 missense probably benign
R1404:Dync1i1 UTSW 6 5915876 missense probably damaging 1.00
R1404:Dync1i1 UTSW 6 5915876 missense probably damaging 1.00
R1499:Dync1i1 UTSW 6 5769799 splice site probably benign
R2119:Dync1i1 UTSW 6 5767096 missense probably damaging 0.97
R3177:Dync1i1 UTSW 6 5972211 critical splice donor site probably null
R3277:Dync1i1 UTSW 6 5972211 critical splice donor site probably null
R4058:Dync1i1 UTSW 6 5769764 missense probably damaging 0.99
R4551:Dync1i1 UTSW 6 5923206 missense probably benign 0.01
R4748:Dync1i1 UTSW 6 5767048 missense possibly damaging 0.66
R5263:Dync1i1 UTSW 6 5969446 missense possibly damaging 0.88
R6193:Dync1i1 UTSW 6 5730679 missense probably benign 0.03
R6280:Dync1i1 UTSW 6 5972084 missense probably benign 0.00
R6933:Dync1i1 UTSW 6 5913333 missense probably damaging 1.00
X0010:Dync1i1 UTSW 6 5972141 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTTCAAGGAGGAAAGCCATTGG -3'
(R):5'- CCTTTCAGAGTGGGGATAGCTTAC -3'

Sequencing Primer
(F):5'- TGGCTGACCTCTAAAAATCCTG -3'
(R):5'- TTACAAAGGTGTGGTAGAAGCTTAAC -3'
Posted On2015-04-30