Incidental Mutation 'R4028:Clec1b'
ID313086
Institutional Source Beutler Lab
Gene Symbol Clec1b
Ensembl Gene ENSMUSG00000030159
Gene NameC-type lectin domain family 1, member b
SynonymsClec2, Clec-2, 1810061I13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.041) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location129397297-129409335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129401811 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 87 (R87H)
Ref Sequence ENSEMBL: ENSMUSP00000107712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032262] [ENSMUST00000112079] [ENSMUST00000112081]
Predicted Effect probably benign
Transcript: ENSMUST00000032262
AA Change: R119H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032262
Gene: ENSMUSG00000030159
AA Change: R119H

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
CLECT 102 217 1.59e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112079
Predicted Effect probably benign
Transcript: ENSMUST00000112081
AA Change: R87H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107712
Gene: ENSMUSG00000030159
AA Change: R87H

DomainStartEndE-ValueType
CLECT 70 185 1.59e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133061
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 (KLRD1; MIM 602894) and NKG2D (KLRC4; MIM 602893), that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 is a C-type lectin-like receptor expressed in myeloid cells and NK cells (Colonna et al., 2000 [PubMed 10671229]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit congestion and hemorrhages during embryogenesis with prenatal and postnatal lethality. Mice homozygous for another knock-out allele exhibit blood-lymph mixing, impaired PDPN-Fc-mediated platelet activation, and intestinal edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Clec1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Clec1b APN 6 129403562 missense probably damaging 1.00
IGL01950:Clec1b APN 6 129400080 missense probably damaging 1.00
IGL02288:Clec1b APN 6 129397623 missense probably damaging 1.00
IGL02411:Clec1b APN 6 129401841 missense probably damaging 1.00
R0471:Clec1b UTSW 6 129401607 splice site probably benign
R4674:Clec1b UTSW 6 129400134 missense probably damaging 0.99
R6211:Clec1b UTSW 6 129401477 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CTCATTTCTCCAAGCAATGCAC -3'
(R):5'- CGTTTCCTAAACTTCTCAGAGGAG -3'

Sequencing Primer
(F):5'- AGCAATGCACATCTGTCGTG -3'
(R):5'- CTTCTCAGAGGAGCACACAGTG -3'
Posted On2015-04-30