Incidental Mutation 'R4028:Olfr552'
ID313089
Institutional Source Beutler Lab
Gene Symbol Olfr552
Ensembl Gene ENSMUSG00000073973
Gene Nameolfactory receptor 552
SynonymsGA_x6K02T2PBJ9-5323062-5324015, MOR28-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102597770-102608125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102605293 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 313 (D313V)
Ref Sequence ENSEMBL: ENSMUSP00000150317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098223] [ENSMUST00000215712]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098223
AA Change: D313V

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095826
Gene: ENSMUSG00000073973
AA Change: D313V

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 6e-118 PFAM
Pfam:7TM_GPCR_Srsx 37 270 4.4e-8 PFAM
Pfam:7tm_1 43 294 9.6e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215712
AA Change: D313V

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Olfr552
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr552 APN 7 102604357 start codon destroyed probably null 0.99
IGL03061:Olfr552 APN 7 102604739 missense probably damaging 0.99
R0989:Olfr552 UTSW 7 102604483 missense probably damaging 1.00
R1513:Olfr552 UTSW 7 102605302 missense probably benign 0.09
R1969:Olfr552 UTSW 7 102604570 missense probably damaging 0.99
R3177:Olfr552 UTSW 7 102604576 missense possibly damaging 0.94
R3277:Olfr552 UTSW 7 102604576 missense possibly damaging 0.94
R4019:Olfr552 UTSW 7 102604642 missense probably damaging 1.00
R5216:Olfr552 UTSW 7 102604821 missense probably benign 0.00
R5444:Olfr552 UTSW 7 102604869 nonsense probably null
R5461:Olfr552 UTSW 7 102604408 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGTCGCATATAGGTGCCATC -3'
(R):5'- TTCCAACAAACTGCCTGCTC -3'

Sequencing Primer
(F):5'- GTCGCATATAGGTGCCATCTTAGC -3'
(R):5'- AACAAACTGCCTGCTCTCTTC -3'
Posted On2015-04-30