Incidental Mutation 'R4028:Trim3'
ID313090
Institutional Source Beutler Lab
Gene Symbol Trim3
Ensembl Gene ENSMUSG00000036989
Gene Nametripartite motif-containing 3
SynonymsHAC1, Rnf22, BERP1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4028 (G1)
Quality Score165
Status Not validated
Chromosome7
Chromosomal Location105604463-105633571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105618245 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 309 (V309A)
Ref Sequence ENSEMBL: ENSMUSP00000114822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057525] [ENSMUST00000106789] [ENSMUST00000106791] [ENSMUST00000147044] [ENSMUST00000153371]
Predicted Effect probably benign
Transcript: ENSMUST00000057525
AA Change: V309A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000053384
Gene: ENSMUSG00000036989
AA Change: V309A

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 2.5e-9 PFAM
Pfam:NHL 533 560 1.9e-9 PFAM
Pfam:NHL 575 602 5.5e-8 PFAM
Pfam:NHL 622 649 1e-10 PFAM
Pfam:NHL 669 696 1.8e-12 PFAM
Pfam:NHL 713 740 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106789
AA Change: V309A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000102401
Gene: ENSMUSG00000036989
AA Change: V309A

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 1.8e-8 PFAM
Pfam:NHL 533 560 3.9e-10 PFAM
Pfam:NHL 575 602 2.3e-7 PFAM
Pfam:NHL 622 649 3.9e-10 PFAM
Pfam:NHL 669 696 2.2e-12 PFAM
Pfam:NHL 713 740 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106791
AA Change: V309A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102403
Gene: ENSMUSG00000036989
AA Change: V309A

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 3.4e-8 PFAM
Pfam:NHL 533 560 7.6e-10 PFAM
Pfam:NHL 575 602 4.4e-7 PFAM
Pfam:NHL 622 649 7.6e-10 PFAM
Pfam:NHL 669 696 2.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140882
Predicted Effect probably benign
Transcript: ENSMUST00000147044
AA Change: V309A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114822
Gene: ENSMUSG00000036989
AA Change: V309A

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150363
Predicted Effect probably benign
Transcript: ENSMUST00000153371
SMART Domains Protein: ENSMUSP00000119910
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 157 3.55e-10 SMART
Blast:BBC 164 199 9e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211532
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also called the 'RING-B-box-coiled-coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic filaments. It is similar to a rat protein which is a specific partner for the tail domain of myosin V, a class of myosins which are involved in the targeted transport of organelles. The rat protein can also interact with alpha-actinin-4. Thus it is suggested that this human protein may play a role in myosin V-mediated cargo transport. Alternatively spliced transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have decreased susceptibility to pharmacologically induced seizure as well as reduced miniature inhibitory synaptic current amplitude in cortical neurons. Mice homozygous for another null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Trim3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trim3 APN 7 105617469 missense probably damaging 1.00
IGL01543:Trim3 APN 7 105613313 missense probably damaging 1.00
IGL01573:Trim3 APN 7 105625493 missense possibly damaging 0.62
IGL01995:Trim3 APN 7 105618482 splice site probably benign
IGL02407:Trim3 APN 7 105613011 missense probably benign 0.44
IGL02868:Trim3 APN 7 105613032 missense possibly damaging 0.82
IGL02837:Trim3 UTSW 7 105612656 missense probably damaging 1.00
R1013:Trim3 UTSW 7 105617895 missense probably benign 0.10
R2296:Trim3 UTSW 7 105613274 missense probably damaging 1.00
R3724:Trim3 UTSW 7 105611189 missense probably damaging 1.00
R4347:Trim3 UTSW 7 105619387 missense probably damaging 1.00
R4383:Trim3 UTSW 7 105618399 missense probably damaging 1.00
R4475:Trim3 UTSW 7 105617802 missense probably damaging 1.00
R4567:Trim3 UTSW 7 105613416 missense possibly damaging 0.88
R4886:Trim3 UTSW 7 105617840 missense probably damaging 1.00
R4981:Trim3 UTSW 7 105619128 missense probably damaging 0.99
R5053:Trim3 UTSW 7 105617761 missense probably damaging 1.00
R5190:Trim3 UTSW 7 105619509 missense probably damaging 1.00
R5230:Trim3 UTSW 7 105619513 missense possibly damaging 0.81
R5364:Trim3 UTSW 7 105619069 missense probably damaging 0.96
R5382:Trim3 UTSW 7 105618347 missense probably benign 0.10
R5712:Trim3 UTSW 7 105619536 missense probably damaging 0.99
R5725:Trim3 UTSW 7 105617740 critical splice donor site probably null
R5915:Trim3 UTSW 7 105617975 missense possibly damaging 0.82
R6058:Trim3 UTSW 7 105611071 missense probably damaging 0.98
R6073:Trim3 UTSW 7 105617539 missense probably damaging 1.00
R6430:Trim3 UTSW 7 105618005 missense probably benign 0.20
R6589:Trim3 UTSW 7 105617960 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCTCTGCACACAGCTCTG -3'
(R):5'- TTGCAGACACAGTTAGACACAC -3'

Sequencing Primer
(F):5'- GCTCTGCGCTGCCTGTG -3'
(R):5'- AGTTAGACACACTGCGCCAGG -3'
Posted On2015-04-30