Incidental Mutation 'R4028:Birc2'
ID313095
Institutional Source Beutler Lab
Gene Symbol Birc2
Ensembl Gene ENSMUSG00000057367
Gene Namebaculoviral IAP repeat-containing 2
SynonymscIAP-1, Api1, HIAP1, IAP1, MIAP1, mcIAP1, MIHB, cIAP1
Accession Numbers

Genbank: NM_007465.2; Ensembl: ENSMUST00000074246

Is this an essential gene? Possibly essential (E-score: 0.631) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location7818227-7837064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7819351 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 520 (N520S)
Ref Sequence ENSEMBL: ENSMUSP00000140049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074246] [ENSMUST00000190341]
Predicted Effect probably benign
Transcript: ENSMUST00000074246
AA Change: N520S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000091422
Gene: ENSMUSG00000057367
AA Change: N520S

DomainStartEndE-ValueType
BIR 44 115 4.06e-33 SMART
BIR 175 245 4.25e-36 SMART
BIR 260 331 2.24e-35 SMART
low complexity region 432 446 N/A INTRINSIC
CARD 447 535 1.64e-20 SMART
low complexity region 552 563 N/A INTRINSIC
RING 565 599 1.65e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190341
AA Change: N520S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000140049
Gene: ENSMUSG00000057367
AA Change: N520S

DomainStartEndE-ValueType
BIR 44 115 4.06e-33 SMART
BIR 175 245 4.25e-36 SMART
BIR 260 331 2.24e-35 SMART
low complexity region 432 446 N/A INTRINSIC
CARD 447 535 1.64e-20 SMART
low complexity region 552 563 N/A INTRINSIC
RING 565 599 1.65e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice showed a modest reduction in the number of lymphocytes. Mice homozygous for a knock-in allele exhibit increased T cell poliferation and IFNG secretion in response to anti-CD3 stimulation. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Birc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Birc2 APN 9 7833665 missense probably damaging 1.00
IGL00972:Birc2 APN 9 7833715 missense probably benign 0.36
IGL02888:Birc2 APN 9 7819558 missense probably benign 0.22
IGL03399:Birc2 APN 9 7821087 missense probably damaging 1.00
1mM(1):Birc2 UTSW 9 7819408 missense probably damaging 0.98
R0409:Birc2 UTSW 9 7819384 missense possibly damaging 0.61
R1617:Birc2 UTSW 9 7826951 missense possibly damaging 0.66
R1864:Birc2 UTSW 9 7819517 missense probably benign 0.06
R2156:Birc2 UTSW 9 7826938 missense probably damaging 1.00
R2519:Birc2 UTSW 9 7821179 missense possibly damaging 0.46
R2867:Birc2 UTSW 9 7834477 start codon destroyed probably null 0.08
R2867:Birc2 UTSW 9 7834477 start codon destroyed probably null 0.08
R4243:Birc2 UTSW 9 7834385 missense probably benign 0.00
R4250:Birc2 UTSW 9 7818935 missense probably benign 0.00
R4584:Birc2 UTSW 9 7833674 missense probably damaging 1.00
R4952:Birc2 UTSW 9 7836740 missense probably damaging 0.99
R5017:Birc2 UTSW 9 7818885 nonsense probably null
R6163:Birc2 UTSW 9 7819035 missense probably benign 0.15
R6789:Birc2 UTSW 9 7836965 intron probably benign
R6795:Birc2 UTSW 9 7833872 missense possibly damaging 0.81
R6941:Birc2 UTSW 9 7819468 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTGAAACGTCTTCTGTTGG -3'
(R):5'- ACAGTTGACACATGTCCTTCC -3'

Sequencing Primer
(F):5'- CTGAAACGTCTTCTGTTGGAATATAC -3'
(R):5'- CTATCCTGGATAATCTTCTTGAGGC -3'
Posted On2015-04-30