Incidental Mutation 'R4028:Chrna5'
ID313096
Institutional Source Beutler Lab
Gene Symbol Chrna5
Ensembl Gene ENSMUSG00000035594
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 5
SynonymsAcra-5, Acra5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location54980880-55007779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54998086 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 61 (W61R)
Ref Sequence ENSEMBL: ENSMUSP00000150942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093844] [ENSMUST00000213960] [ENSMUST00000217408]
Predicted Effect probably damaging
Transcript: ENSMUST00000093844
AA Change: W32R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091365
Gene: ENSMUSG00000035594
AA Change: W32R

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 18 221 4.9e-72 PFAM
Pfam:Neur_chan_memb 228 352 1.9e-51 PFAM
Pfam:Neur_chan_memb 338 417 1.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213960
AA Change: W61R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216865
Predicted Effect probably benign
Transcript: ENSMUST00000217408
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nicotinic acetylcholine receptor subunit and a member of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. These receptors are thought to be heteropentamers composed of separate but similar subunits. Defects in this gene have been linked to susceptibility to lung cancer type 2 (LNCR2).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are less sensitive to nicotine-induced seizures than wild-type controls and exhibit a significantly shorter latency time to seizure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Chrna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Chrna5 APN 9 55004399 missense possibly damaging 0.61
IGL01503:Chrna5 APN 9 54998171 intron probably benign
IGL01617:Chrna5 APN 9 55005013 missense probably damaging 0.98
IGL01935:Chrna5 APN 9 55004843 missense probably benign 0.01
IGL02613:Chrna5 APN 9 55006421 missense probably damaging 0.99
IGL03248:Chrna5 APN 9 55004639 missense probably damaging 1.00
IGL03412:Chrna5 APN 9 55004435 missense probably damaging 1.00
R0712:Chrna5 UTSW 9 55004363 missense probably damaging 1.00
R1619:Chrna5 UTSW 9 55004365 missense probably benign 0.00
R1698:Chrna5 UTSW 9 55004642 missense probably damaging 1.00
R1789:Chrna5 UTSW 9 55004651 missense possibly damaging 0.94
R1800:Chrna5 UTSW 9 55004875 missense probably damaging 0.99
R4030:Chrna5 UTSW 9 54998086 missense probably damaging 1.00
R4031:Chrna5 UTSW 9 54998086 missense probably damaging 1.00
R4201:Chrna5 UTSW 9 54998075 missense probably benign 0.00
R4792:Chrna5 UTSW 9 55004701 missense probably damaging 1.00
R5196:Chrna5 UTSW 9 55006519 missense possibly damaging 0.91
R5718:Chrna5 UTSW 9 54998105 missense probably benign 0.00
R5779:Chrna5 UTSW 9 54998104 missense probably benign 0.35
R6254:Chrna5 UTSW 9 55006456 missense probably benign 0.00
R6492:Chrna5 UTSW 9 54998063 missense probably benign 0.11
R6887:Chrna5 UTSW 9 55005133 missense probably benign 0.00
R6986:Chrna5 UTSW 9 55006457 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AATTCAGGGCCAGCCAATTTC -3'
(R):5'- TCACTCTGGCAACCTCTAGTGG -3'

Sequencing Primer
(F):5'- GGGCCAGCCAATTTCAAACAAAC -3'
(R):5'- TAGTGGCTAACTCACACCTGG -3'
Posted On2015-04-30