Incidental Mutation 'R4028:Wrb'
ID313108
Institutional Source Beutler Lab
Gene Symbol Wrb
Ensembl Gene ENSMUSG00000023147
Gene Nametryptophan rich basic protein
SynonymsC030018G21Rik, Chd5, 5530402J05Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.801) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location96145419-96157852 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 96145584 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023913] [ENSMUST00000135448]
Predicted Effect probably null
Transcript: ENSMUST00000023913
SMART Domains Protein: ENSMUSP00000023913
Gene: ENSMUSG00000023147

DomainStartEndE-ValueType
Pfam:CHD5 12 163 1.4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129569
Predicted Effect silent
Transcript: ENSMUST00000135448
SMART Domains Protein: ENSMUSP00000122059
Gene: ENSMUSG00000023147

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 39 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140476
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic nuclear protein of unknown function. The gene is widely expressed in adult and fetal tissues. Since the region proposed to contain the gene(s) for congenital heart disease (CHD) in Down syndrome (DS) patients has been restricted to 21q22.2-22.3, this gene, which maps to 21q22.3, has a potential role in the pathogenesis of Down syndrome congenital heart disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cox7a2l A G 17: 83,502,640 I123T probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Wrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0413:Wrb UTSW 16 96153017 missense probably benign 0.03
R0740:Wrb UTSW 16 96145598 intron probably benign
R4170:Wrb UTSW 16 96152976 missense probably benign
R4508:Wrb UTSW 16 96145699 intron probably benign
R6021:Wrb UTSW 16 96145678 intron probably benign
Predicted Primers PCR Primer
(F):5'- AAGTAACATCCCATGCTGCC -3'
(R):5'- TGTTCCCACGGACAGAACAG -3'

Sequencing Primer
(F):5'- AGTTGACGACGCTGCTC -3'
(R):5'- AGGCACCTGTGAGGATGCTG -3'
Posted On2015-04-30