Incidental Mutation 'R4028:Cox7a2l'
ID313109
Institutional Source Beutler Lab
Gene Symbol Cox7a2l
Ensembl Gene ENSMUSG00000024248
Gene Namecytochrome c oxidase subunit VIIa polypeptide 2-like
SynonymsSIG81, COX7RP, COX7AR, SIG-81, EB1
Accession Numbers

Genbank: NM_009187; MGI: 106015

Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4028 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location83501919-83514333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83502640 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 123 (I123T)
Ref Sequence ENSEMBL: ENSMUSP00000131584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025095] [ENSMUST00000167741]
Predicted Effect probably benign
Transcript: ENSMUST00000025095
AA Change: I100T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025095
Gene: ENSMUSG00000024248
AA Change: I100T

DomainStartEndE-ValueType
Pfam:COX7a 56 110 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167741
AA Change: I123T

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131584
Gene: ENSMUSG00000024248
AA Change: I123T

DomainStartEndE-ValueType
SCOP:d1ocrj1 56 132 2e-20 SMART
PDB:3WG7|W 56 134 2e-7 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein similar to polypeptides 1 and 2 of subunit VIIa in the C-terminal region, and also highly similar to the mouse Sig81 protein sequence. This gene is expressed in all tissues, and upregulated in a breast cancer cell line after estrogen treatment. It is possible that this gene represents a regulatory subunit of COX and mediates the higher level of energy production in target cells by estrogen. Several transcript variants, some protein-coding and others non-protein coding, have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,996 N503K probably damaging Het
Anapc2 T A 2: 25,277,738 I439N probably damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Birc2 T C 9: 7,819,351 N520S probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Clec1b G A 6: 129,401,811 R87H probably benign Het
Cyp2j5 A T 4: 96,641,416 Y239* probably null Het
Dnajc6 G A 4: 101,616,857 C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 S341F probably damaging Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Fbln1 A G 15: 85,227,116 N157S probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpatch2 A G 1: 187,226,140 S231G possibly damaging Het
Grin2b T C 6: 135,736,435 D816G probably damaging Het
Kndc1 T A 7: 139,930,028 F1261Y probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mrc1 T C 2: 14,238,248 S62P probably damaging Het
Ntrk3 T C 7: 78,192,710 E790G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1264 T C 2: 90,021,223 N281S probably damaging Het
Olfr552 A T 7: 102,605,293 D313V possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Pibf1 A G 14: 99,179,341 E450G probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pkdrej A T 15: 85,817,492 N1414K probably benign Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Slc28a3 T C 13: 58,610,756 S18G probably benign Het
Slc7a1 C A 5: 148,345,812 C75F probably benign Het
Snrnp200 A G 2: 127,237,566 D1865G probably damaging Het
Tnrc6a T A 7: 123,170,121 I378N probably damaging Het
Trim3 A G 7: 105,618,245 V309A probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Wrb T C 16: 96,145,584 probably null Het
Zdhhc11 T C 13: 73,977,271 L210P probably damaging Het
Other mutations in Cox7a2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0103:Cox7a2l UTSW 17 83514272 missense probably damaging 1.00
R0103:Cox7a2l UTSW 17 83514272 missense probably damaging 1.00
R1828:Cox7a2l UTSW 17 83503968 missense probably benign 0.00
R6088:Cox7a2l UTSW 17 83503972 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGACATCTGACAGGCCATC -3'
(R):5'- CCCAGTTGCCCGCTATATTG -3'

Sequencing Primer
(F):5'- CAGGCCATCTGCACACC -3'
(R):5'- AGTACACTGTAGCTGTCTTCAGAC -3'
Posted On2015-04-30