Incidental Mutation 'R4028:Cox7a2l'
ID 313109
Institutional Source Beutler Lab
Gene Symbol Cox7a2l
Ensembl Gene ENSMUSG00000024248
Gene Name cytochrome c oxidase subunit 7A2 like
Synonyms SIG-81, COX7RP, COX7AR, EB1, SIG81, Scaf1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R4028 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 83809346-83821762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83810069 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 123 (I123T)
Ref Sequence ENSEMBL: ENSMUSP00000131584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025095] [ENSMUST00000167741]
AlphaFold Q61387
Predicted Effect probably benign
Transcript: ENSMUST00000025095
AA Change: I100T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025095
Gene: ENSMUSG00000024248
AA Change: I100T

DomainStartEndE-ValueType
Pfam:COX7a 56 110 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167741
AA Change: I123T

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131584
Gene: ENSMUSG00000024248
AA Change: I123T

DomainStartEndE-ValueType
SCOP:d1ocrj1 56 132 2e-20 SMART
PDB:3WG7|W 56 134 2e-7 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein similar to polypeptides 1 and 2 of subunit VIIa in the C-terminal region, and also highly similar to the mouse Sig81 protein sequence. This gene is expressed in all tissues, and upregulated in a breast cancer cell line after estrogen treatment. It is possible that this gene represents a regulatory subunit of COX and mediates the higher level of energy production in target cells by estrogen. Several transcript variants, some protein-coding and others non-protein coding, have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,531,725 (GRCm39) N503K probably damaging Het
Anapc2 T A 2: 25,167,750 (GRCm39) I439N probably damaging Het
Ank A G 15: 27,544,343 (GRCm39) N35D probably damaging Het
Birc2 T C 9: 7,819,352 (GRCm39) N520S probably benign Het
C030005K15Rik T C 10: 97,561,404 (GRCm39) Y109C unknown Het
Chrna5 T C 9: 54,905,370 (GRCm39) W61R probably damaging Het
Clec1b G A 6: 129,378,774 (GRCm39) R87H probably benign Het
Cyp2j5 A T 4: 96,529,653 (GRCm39) Y239* probably null Het
Dnajc6 G A 4: 101,474,054 (GRCm39) C485Y probably damaging Het
Dync1i1 C T 6: 5,961,842 (GRCm39) S341F probably damaging Het
Fbln1 A G 15: 85,111,317 (GRCm39) N157S probably benign Het
Get1 T C 16: 95,946,784 (GRCm39) probably null Het
Gpatch2 A G 1: 186,958,337 (GRCm39) S231G possibly damaging Het
Grin2b T C 6: 135,713,433 (GRCm39) D816G probably damaging Het
Kndc1 T A 7: 139,509,941 (GRCm39) F1261Y probably damaging Het
Lefty1 T C 1: 180,765,346 (GRCm39) S305P probably benign Het
Ltbp3 G A 19: 5,804,050 (GRCm39) R854Q probably benign Het
Mrc1 T C 2: 14,243,059 (GRCm39) S62P probably damaging Het
Ntrk3 T C 7: 77,842,458 (GRCm39) E790G probably damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Oog4 A T 4: 143,166,770 (GRCm39) N11K probably benign Het
Or4c3 T C 2: 89,851,567 (GRCm39) N281S probably damaging Het
Or52k2 A T 7: 102,254,500 (GRCm39) D313V possibly damaging Het
Pibf1 A G 14: 99,416,777 (GRCm39) E450G probably damaging Het
Pkd1l3 T A 8: 110,350,603 (GRCm39) S483T possibly damaging Het
Pkdrej A T 15: 85,701,693 (GRCm39) N1414K probably benign Het
Pld2 A G 11: 70,445,731 (GRCm39) N655S probably damaging Het
Pramel28 T A 4: 143,692,354 (GRCm39) T216S probably benign Het
Rcn1 G T 2: 105,229,395 (GRCm39) Y52* probably null Het
Reck T C 4: 43,922,931 (GRCm39) I402T probably damaging Het
Shisal2a G T 4: 108,240,412 (GRCm39) C43* probably null Het
Slc28a3 T C 13: 58,758,570 (GRCm39) S18G probably benign Het
Slc7a1 C A 5: 148,282,622 (GRCm39) C75F probably benign Het
Snrnp200 A G 2: 127,079,486 (GRCm39) D1865G probably damaging Het
Tnrc6a T A 7: 122,769,344 (GRCm39) I378N probably damaging Het
Trim3 A G 7: 105,267,452 (GRCm39) V309A probably benign Het
Tshz1 T C 18: 84,032,954 (GRCm39) K485E possibly damaging Het
Zdhhc11 T C 13: 74,125,390 (GRCm39) L210P probably damaging Het
Other mutations in Cox7a2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0103:Cox7a2l UTSW 17 83,821,701 (GRCm39) missense probably damaging 1.00
R0103:Cox7a2l UTSW 17 83,821,701 (GRCm39) missense probably damaging 1.00
R1828:Cox7a2l UTSW 17 83,811,397 (GRCm39) missense probably benign 0.00
R6088:Cox7a2l UTSW 17 83,811,401 (GRCm39) missense probably benign 0.01
R9615:Cox7a2l UTSW 17 83,821,701 (GRCm39) missense possibly damaging 0.86
RF026:Cox7a2l UTSW 17 83,810,151 (GRCm39) small insertion probably benign
RF030:Cox7a2l UTSW 17 83,810,151 (GRCm39) small insertion probably benign
RF034:Cox7a2l UTSW 17 83,810,151 (GRCm39) small insertion probably benign
RF037:Cox7a2l UTSW 17 83,810,151 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCTGACATCTGACAGGCCATC -3'
(R):5'- CCCAGTTGCCCGCTATATTG -3'

Sequencing Primer
(F):5'- CAGGCCATCTGCACACC -3'
(R):5'- AGTACACTGTAGCTGTCTTCAGAC -3'
Posted On 2015-04-30