Incidental Mutation 'R4028:Cox7a2l'
ID |
313109 |
Institutional Source |
Beutler Lab
|
Gene Symbol |
Cox7a2l
|
Ensembl Gene |
ENSMUSG00000024248 |
Gene Name |
cytochrome c oxidase subunit 7A2 like |
Synonyms |
SIG-81, COX7RP, COX7AR, EB1, SIG81, Scaf1 |
Accession Numbers |
|
Essential gene? |
Probably non essential
(E-score: 0.170)
|
Stock # |
R4028 (G1)
|
Quality Score |
225 |
Status
|
Not validated
|
Chromosome |
17 |
Chromosomal Location |
83809346-83821762 bp(-) (GRCm39) |
Type of Mutation |
missense |
DNA Base Change (assembly) |
A to G
at 83810069 bp (GRCm39)
|
Zygosity |
Heterozygous |
Amino Acid Change |
Isoleucine to Threonine
at position 123
(I123T)
|
Ref Sequence |
ENSEMBL: ENSMUSP00000131584
(fasta)
|
Gene Model |
predicted gene model for transcript(s):
[ENSMUST00000025095]
[ENSMUST00000167741]
|
AlphaFold |
Q61387 |
Predicted Effect |
probably benign
Transcript: ENSMUST00000025095
AA Change: I100T
PolyPhen 2
Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
|
SMART Domains |
Protein: ENSMUSP00000025095 Gene: ENSMUSG00000024248 AA Change: I100T
Domain | Start | End | E-Value | Type |
Pfam:COX7a
|
56 |
110 |
4.8e-30 |
PFAM |
|
Predicted Effect |
probably benign
Transcript: ENSMUST00000167741
AA Change: I123T
PolyPhen 2
Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
|
SMART Domains |
Protein: ENSMUSP00000131584 Gene: ENSMUSG00000024248 AA Change: I123T
Domain | Start | End | E-Value | Type |
SCOP:d1ocrj1
|
56 |
132 |
2e-20 |
SMART |
PDB:3WG7|W
|
56 |
134 |
2e-7 |
PDB |
|
Coding Region Coverage |
- 1x: 99.1%
- 3x: 98.5%
- 10x: 96.8%
- 20x: 93.2%
|
Validation Efficiency |
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein similar to polypeptides 1 and 2 of subunit VIIa in the C-terminal region, and also highly similar to the mouse Sig81 protein sequence. This gene is expressed in all tissues, and upregulated in a breast cancer cell line after estrogen treatment. It is possible that this gene represents a regulatory subunit of COX and mediates the higher level of energy production in target cells by estrogen. Several transcript variants, some protein-coding and others non-protein coding, have been found for this gene. [provided by RefSeq, Jan 2016]
|
Allele List at MGI |
All alleles(10) : Gene trapped(10) |
Other mutations in this stock |
Total: 38 list
Gene | Ref | Var | Chr/Loc | Mutation | Predicted Effect | Zygosity |
Adam12 |
A |
T |
7: 133,531,725 (GRCm39) |
N503K |
probably damaging |
Het |
Anapc2 |
T |
A |
2: 25,167,750 (GRCm39) |
I439N |
probably damaging |
Het |
Ank |
A |
G |
15: 27,544,343 (GRCm39) |
N35D |
probably damaging |
Het |
Birc2 |
T |
C |
9: 7,819,352 (GRCm39) |
N520S |
probably benign |
Het |
C030005K15Rik |
T |
C |
10: 97,561,404 (GRCm39) |
Y109C |
unknown |
Het |
Chrna5 |
T |
C |
9: 54,905,370 (GRCm39) |
W61R |
probably damaging |
Het |
Clec1b |
G |
A |
6: 129,378,774 (GRCm39) |
R87H |
probably benign |
Het |
Cyp2j5 |
A |
T |
4: 96,529,653 (GRCm39) |
Y239* |
probably null |
Het |
Dnajc6 |
G |
A |
4: 101,474,054 (GRCm39) |
C485Y |
probably damaging |
Het |
Dync1i1 |
C |
T |
6: 5,961,842 (GRCm39) |
S341F |
probably damaging |
Het |
Fbln1 |
A |
G |
15: 85,111,317 (GRCm39) |
N157S |
probably benign |
Het |
Get1 |
T |
C |
16: 95,946,784 (GRCm39) |
|
probably null |
Het |
Gpatch2 |
A |
G |
1: 186,958,337 (GRCm39) |
S231G |
possibly damaging |
Het |
Grin2b |
T |
C |
6: 135,713,433 (GRCm39) |
D816G |
probably damaging |
Het |
Kndc1 |
T |
A |
7: 139,509,941 (GRCm39) |
F1261Y |
probably damaging |
Het |
Lefty1 |
T |
C |
1: 180,765,346 (GRCm39) |
S305P |
probably benign |
Het |
Ltbp3 |
G |
A |
19: 5,804,050 (GRCm39) |
R854Q |
probably benign |
Het |
Mrc1 |
T |
C |
2: 14,243,059 (GRCm39) |
S62P |
probably damaging |
Het |
Ntrk3 |
T |
C |
7: 77,842,458 (GRCm39) |
E790G |
probably damaging |
Het |
Obscn |
T |
C |
11: 59,022,472 (GRCm39) |
R758G |
possibly damaging |
Het |
Oog4 |
A |
T |
4: 143,166,770 (GRCm39) |
N11K |
probably benign |
Het |
Or4c3 |
T |
C |
2: 89,851,567 (GRCm39) |
N281S |
probably damaging |
Het |
Or52k2 |
A |
T |
7: 102,254,500 (GRCm39) |
D313V |
possibly damaging |
Het |
Pibf1 |
A |
G |
14: 99,416,777 (GRCm39) |
E450G |
probably damaging |
Het |
Pkd1l3 |
T |
A |
8: 110,350,603 (GRCm39) |
S483T |
possibly damaging |
Het |
Pkdrej |
A |
T |
15: 85,701,693 (GRCm39) |
N1414K |
probably benign |
Het |
Pld2 |
A |
G |
11: 70,445,731 (GRCm39) |
N655S |
probably damaging |
Het |
Pramel28 |
T |
A |
4: 143,692,354 (GRCm39) |
T216S |
probably benign |
Het |
Rcn1 |
G |
T |
2: 105,229,395 (GRCm39) |
Y52* |
probably null |
Het |
Reck |
T |
C |
4: 43,922,931 (GRCm39) |
I402T |
probably damaging |
Het |
Shisal2a |
G |
T |
4: 108,240,412 (GRCm39) |
C43* |
probably null |
Het |
Slc28a3 |
T |
C |
13: 58,758,570 (GRCm39) |
S18G |
probably benign |
Het |
Slc7a1 |
C |
A |
5: 148,282,622 (GRCm39) |
C75F |
probably benign |
Het |
Snrnp200 |
A |
G |
2: 127,079,486 (GRCm39) |
D1865G |
probably damaging |
Het |
Tnrc6a |
T |
A |
7: 122,769,344 (GRCm39) |
I378N |
probably damaging |
Het |
Trim3 |
A |
G |
7: 105,267,452 (GRCm39) |
V309A |
probably benign |
Het |
Tshz1 |
T |
C |
18: 84,032,954 (GRCm39) |
K485E |
possibly damaging |
Het |
Zdhhc11 |
T |
C |
13: 74,125,390 (GRCm39) |
L210P |
probably damaging |
Het |
|
Other mutations in Cox7a2l |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
R0103:Cox7a2l
|
UTSW |
17 |
83,821,701 (GRCm39) |
missense |
probably damaging |
1.00 |
R0103:Cox7a2l
|
UTSW |
17 |
83,821,701 (GRCm39) |
missense |
probably damaging |
1.00 |
R1828:Cox7a2l
|
UTSW |
17 |
83,811,397 (GRCm39) |
missense |
probably benign |
0.00 |
R6088:Cox7a2l
|
UTSW |
17 |
83,811,401 (GRCm39) |
missense |
probably benign |
0.01 |
R9615:Cox7a2l
|
UTSW |
17 |
83,821,701 (GRCm39) |
missense |
possibly damaging |
0.86 |
RF026:Cox7a2l
|
UTSW |
17 |
83,810,151 (GRCm39) |
small insertion |
probably benign |
|
RF030:Cox7a2l
|
UTSW |
17 |
83,810,151 (GRCm39) |
small insertion |
probably benign |
|
RF034:Cox7a2l
|
UTSW |
17 |
83,810,151 (GRCm39) |
small insertion |
probably benign |
|
RF037:Cox7a2l
|
UTSW |
17 |
83,810,151 (GRCm39) |
small insertion |
probably benign |
|
|
Predicted Primers |
PCR Primer
(F):5'- TCTGACATCTGACAGGCCATC -3'
(R):5'- CCCAGTTGCCCGCTATATTG -3'
Sequencing Primer
(F):5'- CAGGCCATCTGCACACC -3'
(R):5'- AGTACACTGTAGCTGTCTTCAGAC -3'
|
Posted On |
2015-04-30 |