Incidental Mutation 'R0386:Tbc1d23'
ID31311
Institutional Source Beutler Lab
Gene Symbol Tbc1d23
Ensembl Gene ENSMUSG00000022749
Gene NameTBC1 domain family, member 23
Synonyms4930451A13Rik, D030022P07Rik
MMRRC Submission 038592-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R0386 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location57168862-57231504 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57189273 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 418 (H418Y)
Ref Sequence ENSEMBL: ENSMUSP00000023431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023431] [ENSMUST00000226586]
Predicted Effect probably damaging
Transcript: ENSMUST00000023431
AA Change: H418Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023431
Gene: ENSMUSG00000022749
AA Change: H418Y

DomainStartEndE-ValueType
TBC 41 249 7.22e-5 SMART
RHOD 323 443 7.83e-1 SMART
low complexity region 459 472 N/A INTRINSIC
Blast:TBC 506 630 8e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000226586
AA Change: H418Y

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231435
Meta Mutation Damage Score 0.378 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased serum cytokine production and inflammatory cells in the peritoneum following i.p. lipopolysaccharide injection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,461 V194A probably damaging Het
Adamts13 G A 2: 26,986,679 probably null Het
Ahnak T C 19: 9,011,144 M3264T possibly damaging Het
Birc6 T A 17: 74,599,340 C1409S probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Dnah2 A G 11: 69,447,861 V3161A probably damaging Het
Dnah5 A T 15: 28,383,581 Y2983F probably damaging Het
Dnah6 G A 6: 73,083,124 L2774F probably damaging Het
Dst A T 1: 34,217,836 T4398S probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Efcab5 A T 11: 77,172,378 M96K probably benign Het
Elavl4 A G 4: 110,206,705 probably benign Het
Flt4 G A 11: 49,644,386 A1214T probably benign Het
Fn1 G T 1: 71,595,786 T2127N probably damaging Het
Foxj1 A T 11: 116,331,803 S391R possibly damaging Het
Gabrb1 A T 5: 72,108,807 Y269F probably damaging Het
Ghitm A G 14: 37,125,911 S259P possibly damaging Het
Gm16332 A G 1: 139,924,190 noncoding transcript Het
Gm16380 T A 9: 53,884,443 noncoding transcript Het
Gm9869 A T 9: 60,838,062 probably benign Het
Gm9936 G A 5: 114,857,131 Q142* probably null Het
Hmbs T C 9: 44,337,008 Y260C probably benign Het
Hoxc5 T A 15: 103,015,352 C193* probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Lce1j T C 3: 92,789,388 K28E unknown Het
Lpgat1 C T 1: 191,719,348 probably benign Het
Lyst T C 13: 13,708,214 probably benign Het
Megf11 A G 9: 64,640,078 N235D probably damaging Het
Mst1r T A 9: 107,916,804 probably null Het
Nr2c2ap A G 8: 70,131,587 D9G probably benign Het
Obscn T C 11: 59,136,339 T13A probably damaging Het
Ofcc1 A C 13: 40,214,474 L188* probably null Het
Olfr1028 A G 2: 85,951,873 E270G probably damaging Het
Olfr432 A T 1: 174,050,399 T9S probably benign Het
Oma1 A T 4: 103,325,201 probably benign Het
Pcm1 T C 8: 41,316,023 F1642S probably damaging Het
Pglyrp2 A G 17: 32,420,862 M1T probably null Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm10 C A 9: 31,316,300 T67K probably damaging Het
Ralgapa1 A T 12: 55,708,067 H1193Q probably benign Het
Sall1 A G 8: 89,032,604 S291P probably damaging Het
Sdk2 T C 11: 113,893,464 T150A probably damaging Het
Sel1l2 T A 2: 140,275,441 Y170F probably benign Het
Sema4a C T 3: 88,436,800 V715I possibly damaging Het
Smgc G A 15: 91,854,638 A500T probably benign Het
Spef2 A G 15: 9,584,062 V1639A probably damaging Het
Srrm4 A G 5: 116,482,378 probably benign Het
Tbk1 A G 10: 121,584,254 L10P probably damaging Het
Thumpd3 G A 6: 113,065,660 probably null Het
Trp53bp1 G T 2: 121,204,943 T1609K probably damaging Het
Tut1 A G 19: 8,955,555 N84S probably benign Het
Urb1 C T 16: 90,796,399 G282R probably damaging Het
Usp19 A T 9: 108,499,711 D1160V probably damaging Het
Usp9y A G Y: 1,316,933 V1872A probably damaging Het
Zfp276 C A 8: 123,259,503 Y386* probably null Het
Other mutations in Tbc1d23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Tbc1d23 APN 16 57171776 missense probably damaging 1.00
IGL01063:Tbc1d23 APN 16 57192675 missense probably benign 0.04
IGL01951:Tbc1d23 APN 16 57186685 splice site probably benign
IGL01980:Tbc1d23 APN 16 57189252 splice site probably benign
IGL02457:Tbc1d23 APN 16 57170391 missense probably damaging 1.00
IGL02937:Tbc1d23 APN 16 57184415 missense possibly damaging 0.94
IGL03226:Tbc1d23 APN 16 57214262 missense probably damaging 1.00
R0472:Tbc1d23 UTSW 16 57173106 missense possibly damaging 0.74
R0479:Tbc1d23 UTSW 16 57171814 missense probably damaging 1.00
R0609:Tbc1d23 UTSW 16 57173106 missense possibly damaging 0.74
R1124:Tbc1d23 UTSW 16 57214162 critical splice donor site probably null
R1430:Tbc1d23 UTSW 16 57214210 missense probably damaging 1.00
R1797:Tbc1d23 UTSW 16 57173100 missense possibly damaging 0.90
R1978:Tbc1d23 UTSW 16 57189351 missense probably benign
R4675:Tbc1d23 UTSW 16 57182962 missense possibly damaging 0.72
R4756:Tbc1d23 UTSW 16 57198895 frame shift probably null
R4781:Tbc1d23 UTSW 16 57218415 missense possibly damaging 0.87
R4799:Tbc1d23 UTSW 16 57192628 missense probably benign 0.01
R4895:Tbc1d23 UTSW 16 57198857 critical splice donor site probably null
R5389:Tbc1d23 UTSW 16 57198928 missense probably damaging 1.00
R5601:Tbc1d23 UTSW 16 57198309 missense probably benign 0.02
R6041:Tbc1d23 UTSW 16 57173150 missense probably benign 0.14
R6176:Tbc1d23 UTSW 16 57171789 missense probably damaging 1.00
R6195:Tbc1d23 UTSW 16 57231350 missense possibly damaging 0.56
R6228:Tbc1d23 UTSW 16 57182903 missense probably damaging 0.98
R6232:Tbc1d23 UTSW 16 57170433 missense probably benign 0.39
R6484:Tbc1d23 UTSW 16 57178016 missense probably damaging 1.00
R6670:Tbc1d23 UTSW 16 57214217 missense probably benign 0.00
R6957:Tbc1d23 UTSW 16 57208323 missense probably damaging 1.00
R7218:Tbc1d23 UTSW 16 57170382 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCAACACAGTGATAAATGGCACAGT -3'
(R):5'- CCAGAATCCATCTGAGTTTGCACAGT -3'

Sequencing Primer
(F):5'- AATGGCACAGTAATTTTCCTACCTC -3'
(R):5'- GCACAGTCAGTAAAGTCCTTG -3'
Posted On2013-04-24