Incidental Mutation 'R4029:Psmd2'
ID 313139
Institutional Source Beutler Lab
Gene Symbol Psmd2
Ensembl Gene ENSMUSG00000006998
Gene Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
Synonyms TEG-190, Tex190, 9430095H01Rik
MMRRC Submission 040959-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R4029 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 20470402-20482164 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 20481955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 896 (G896D)
Ref Sequence ENSEMBL: ENSMUSP00000007212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007212] [ENSMUST00000172207]
AlphaFold Q8VDM4
Predicted Effect probably damaging
Transcript: ENSMUST00000007212
AA Change: G896D

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000007212
Gene: ENSMUSG00000006998
AA Change: G896D

DomainStartEndE-ValueType
Pfam:PC_rep 443 479 3.7e-9 PFAM
Pfam:PC_rep 480 514 1.3e-8 PFAM
low complexity region 571 581 N/A INTRINSIC
SCOP:d1gw5b_ 617 773 1e-8 SMART
PDB:4CR4|Z 653 906 3e-57 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169184
Predicted Effect probably benign
Transcript: ENSMUST00000172207
Predicted Effect probably benign
Transcript: ENSMUST00000231897
Predicted Effect probably benign
Transcript: ENSMUST00000232513
Meta Mutation Damage Score 0.9078 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. In addition to participation in proteasome function, this subunit may also participate in the TNF signalling pathway since it interacts with the tumor necrosis factor type 1 receptor. A pseudogene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,293,008 (GRCm39) K46R probably benign Het
Ank A G 15: 27,544,343 (GRCm39) N35D probably damaging Het
Atp9a A T 2: 168,531,245 (GRCm39) I174N probably damaging Het
Bfsp1 G A 2: 143,673,749 (GRCm39) probably benign Het
Cenpq T C 17: 41,238,140 (GRCm39) T125A probably damaging Het
Dcun1d4 A G 5: 73,691,980 (GRCm39) D89G probably damaging Het
Dip2b A G 15: 100,084,053 (GRCm39) Y892C probably damaging Het
Dmrt2 T G 19: 25,655,498 (GRCm39) S366A probably damaging Het
Exoc7 C T 11: 116,197,814 (GRCm39) probably benign Het
Gabra4 G T 5: 71,729,532 (GRCm39) T390K probably benign Het
Gpr68 A G 12: 100,845,475 (GRCm39) L23P probably damaging Het
Krt17 T A 11: 100,148,349 (GRCm39) N364I probably damaging Het
Lefty1 T C 1: 180,765,346 (GRCm39) S305P probably benign Het
Ly6g6d T A 17: 35,290,636 (GRCm39) Q98L probably benign Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Nck2 T C 1: 43,593,251 (GRCm39) F153L probably benign Het
Niban1 G A 1: 151,571,441 (GRCm39) V239I probably benign Het
Nme4 T C 17: 26,313,196 (GRCm39) probably null Het
Nup35 A G 2: 80,483,318 (GRCm39) D172G probably benign Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Oog4 A T 4: 143,166,770 (GRCm39) N11K probably benign Het
Phlpp1 T A 1: 106,320,279 (GRCm39) S1425T probably damaging Het
Pkd1l3 T A 8: 110,350,603 (GRCm39) S483T possibly damaging Het
Pld2 A G 11: 70,445,731 (GRCm39) N655S probably damaging Het
Pramel28 T A 4: 143,692,354 (GRCm39) T216S probably benign Het
Rcn1 G T 2: 105,229,395 (GRCm39) Y52* probably null Het
Reck T C 4: 43,922,931 (GRCm39) I402T probably damaging Het
Shisal2a G T 4: 108,240,412 (GRCm39) C43* probably null Het
Ston2 T C 12: 91,615,037 (GRCm39) Q457R possibly damaging Het
Syt10 T C 15: 89,698,741 (GRCm39) E201G probably benign Het
Ube4a G A 9: 44,861,198 (GRCm39) probably benign Het
Wdr49 C A 3: 75,230,972 (GRCm39) L563F probably benign Het
Other mutations in Psmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Psmd2 APN 16 20,478,155 (GRCm39) splice site probably null
IGL02348:Psmd2 APN 16 20,473,397 (GRCm39) missense probably benign 0.07
IGL02352:Psmd2 APN 16 20,475,691 (GRCm39) missense probably benign 0.13
IGL02359:Psmd2 APN 16 20,475,691 (GRCm39) missense probably benign 0.13
R0012:Psmd2 UTSW 16 20,480,434 (GRCm39) missense probably damaging 0.99
R0144:Psmd2 UTSW 16 20,480,975 (GRCm39) splice site probably null
R0565:Psmd2 UTSW 16 20,479,176 (GRCm39) missense probably null 0.63
R0739:Psmd2 UTSW 16 20,474,079 (GRCm39) missense probably benign 0.01
R1075:Psmd2 UTSW 16 20,478,709 (GRCm39) missense probably damaging 0.98
R1189:Psmd2 UTSW 16 20,480,644 (GRCm39) missense probably benign 0.17
R1231:Psmd2 UTSW 16 20,474,335 (GRCm39) missense possibly damaging 0.83
R1405:Psmd2 UTSW 16 20,471,034 (GRCm39) missense possibly damaging 0.83
R1405:Psmd2 UTSW 16 20,471,034 (GRCm39) missense possibly damaging 0.83
R1466:Psmd2 UTSW 16 20,476,715 (GRCm39) unclassified probably benign
R1556:Psmd2 UTSW 16 20,474,335 (GRCm39) missense possibly damaging 0.83
R1843:Psmd2 UTSW 16 20,475,332 (GRCm39) missense probably benign 0.02
R2398:Psmd2 UTSW 16 20,478,222 (GRCm39) missense possibly damaging 0.86
R2421:Psmd2 UTSW 16 20,478,856 (GRCm39) splice site probably null
R2520:Psmd2 UTSW 16 20,481,826 (GRCm39) missense probably damaging 1.00
R3040:Psmd2 UTSW 16 20,476,317 (GRCm39) missense probably benign 0.08
R3905:Psmd2 UTSW 16 20,474,392 (GRCm39) missense probably benign 0.07
R3906:Psmd2 UTSW 16 20,474,392 (GRCm39) missense probably benign 0.07
R3909:Psmd2 UTSW 16 20,474,392 (GRCm39) missense probably benign 0.07
R4027:Psmd2 UTSW 16 20,481,955 (GRCm39) missense probably damaging 0.98
R4031:Psmd2 UTSW 16 20,481,955 (GRCm39) missense probably damaging 0.98
R4357:Psmd2 UTSW 16 20,475,402 (GRCm39) missense probably benign
R4410:Psmd2 UTSW 16 20,473,776 (GRCm39) missense probably damaging 0.96
R4678:Psmd2 UTSW 16 20,478,719 (GRCm39) missense probably damaging 1.00
R4737:Psmd2 UTSW 16 20,478,565 (GRCm39) unclassified probably benign
R4771:Psmd2 UTSW 16 20,481,429 (GRCm39) missense probably damaging 0.99
R5081:Psmd2 UTSW 16 20,480,405 (GRCm39) missense probably benign 0.14
R5124:Psmd2 UTSW 16 20,471,448 (GRCm39) missense possibly damaging 0.93
R5801:Psmd2 UTSW 16 20,473,672 (GRCm39) missense probably damaging 0.96
R6381:Psmd2 UTSW 16 20,474,023 (GRCm39) missense probably benign 0.03
R6732:Psmd2 UTSW 16 20,481,386 (GRCm39) missense probably benign 0.02
R6870:Psmd2 UTSW 16 20,480,593 (GRCm39) missense probably benign 0.33
R7030:Psmd2 UTSW 16 20,480,883 (GRCm39) missense probably damaging 1.00
R7137:Psmd2 UTSW 16 20,471,377 (GRCm39) missense probably benign 0.12
R7432:Psmd2 UTSW 16 20,473,675 (GRCm39) missense probably damaging 0.99
R8673:Psmd2 UTSW 16 20,475,638 (GRCm39) missense probably damaging 1.00
R8685:Psmd2 UTSW 16 20,474,161 (GRCm39) missense probably benign
R9110:Psmd2 UTSW 16 20,470,994 (GRCm39) missense probably damaging 0.99
R9192:Psmd2 UTSW 16 20,473,412 (GRCm39) missense probably damaging 1.00
R9341:Psmd2 UTSW 16 20,475,441 (GRCm39) critical splice donor site probably null
R9343:Psmd2 UTSW 16 20,475,441 (GRCm39) critical splice donor site probably null
R9504:Psmd2 UTSW 16 20,478,160 (GRCm39) missense probably benign
R9526:Psmd2 UTSW 16 20,474,369 (GRCm39) missense probably benign 0.04
R9689:Psmd2 UTSW 16 20,479,173 (GRCm39) missense probably benign 0.05
Z1176:Psmd2 UTSW 16 20,481,410 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGGATATTGCTTCTCCCG -3'
(R):5'- AGGCTGAACAGTGCTTCCTC -3'

Sequencing Primer
(F):5'- TCCCGTTTCTGGAATCTGTAC -3'
(R):5'- GCTGAACAGTGCTTCCTCACATC -3'
Posted On 2015-04-30