Incidental Mutation 'R0386:Tut1'
ID31314
Institutional Source Beutler Lab
Gene Symbol Tut1
Ensembl Gene ENSMUSG00000071645
Gene Nameterminal uridylyl transferase 1, U6 snRNA-specific
SynonymsPAPD2, Rbm21, 2700038E08Rik, TUTase6
MMRRC Submission 038592-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.610) question?
Stock #R0386 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8953850-8966207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8955555 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 84 (N84S)
Ref Sequence ENSEMBL: ENSMUSP00000093958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096239] [ENSMUST00000096240]
Predicted Effect probably benign
Transcript: ENSMUST00000096239
AA Change: N84S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000093958
Gene: ENSMUSG00000071645
AA Change: N84S

DomainStartEndE-ValueType
ZnF_C2H2 16 40 1.53e-1 SMART
RRM 57 124 2.02e-10 SMART
SCOP:d1f5aa2 173 221 1e-3 SMART
low complexity region 242 258 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 324 347 N/A INTRINSIC
low complexity region 423 434 N/A INTRINSIC
Pfam:PAP_assoc 493 552 2.7e-8 PFAM
low complexity region 594 618 N/A INTRINSIC
low complexity region 767 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096240
SMART Domains Protein: ENSMUSP00000093959
Gene: ENSMUSG00000071646

DomainStartEndE-ValueType
BAH 4 144 7.34e-34 SMART
ELM2 147 201 5.58e-15 SMART
SANT 264 313 2.24e-7 SMART
ZnF_GATA 361 415 5.5e-15 SMART
low complexity region 475 490 N/A INTRINSIC
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleotidyl transferase that functions as both a terminal uridylyltransferase and a nuclear poly(A) polymerase. The encoded enzyme specifically adds and removes nucleotides from the 3' end of small nuclear RNAs and select mRNAs and may function in controlling gene expression and cell proliferation.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,461 V194A probably damaging Het
Adamts13 G A 2: 26,986,679 probably null Het
Ahnak T C 19: 9,011,144 M3264T possibly damaging Het
Birc6 T A 17: 74,599,340 C1409S probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Dnah2 A G 11: 69,447,861 V3161A probably damaging Het
Dnah5 A T 15: 28,383,581 Y2983F probably damaging Het
Dnah6 G A 6: 73,083,124 L2774F probably damaging Het
Dst A T 1: 34,217,836 T4398S probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Efcab5 A T 11: 77,172,378 M96K probably benign Het
Elavl4 A G 4: 110,206,705 probably benign Het
Flt4 G A 11: 49,644,386 A1214T probably benign Het
Fn1 G T 1: 71,595,786 T2127N probably damaging Het
Foxj1 A T 11: 116,331,803 S391R possibly damaging Het
Gabrb1 A T 5: 72,108,807 Y269F probably damaging Het
Ghitm A G 14: 37,125,911 S259P possibly damaging Het
Gm16332 A G 1: 139,924,190 noncoding transcript Het
Gm16380 T A 9: 53,884,443 noncoding transcript Het
Gm9869 A T 9: 60,838,062 probably benign Het
Gm9936 G A 5: 114,857,131 Q142* probably null Het
Hmbs T C 9: 44,337,008 Y260C probably benign Het
Hoxc5 T A 15: 103,015,352 C193* probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Lce1j T C 3: 92,789,388 K28E unknown Het
Lpgat1 C T 1: 191,719,348 probably benign Het
Lyst T C 13: 13,708,214 probably benign Het
Megf11 A G 9: 64,640,078 N235D probably damaging Het
Mst1r T A 9: 107,916,804 probably null Het
Nr2c2ap A G 8: 70,131,587 D9G probably benign Het
Obscn T C 11: 59,136,339 T13A probably damaging Het
Ofcc1 A C 13: 40,214,474 L188* probably null Het
Olfr1028 A G 2: 85,951,873 E270G probably damaging Het
Olfr432 A T 1: 174,050,399 T9S probably benign Het
Oma1 A T 4: 103,325,201 probably benign Het
Pcm1 T C 8: 41,316,023 F1642S probably damaging Het
Pglyrp2 A G 17: 32,420,862 M1T probably null Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm10 C A 9: 31,316,300 T67K probably damaging Het
Ralgapa1 A T 12: 55,708,067 H1193Q probably benign Het
Sall1 A G 8: 89,032,604 S291P probably damaging Het
Sdk2 T C 11: 113,893,464 T150A probably damaging Het
Sel1l2 T A 2: 140,275,441 Y170F probably benign Het
Sema4a C T 3: 88,436,800 V715I possibly damaging Het
Smgc G A 15: 91,854,638 A500T probably benign Het
Spef2 A G 15: 9,584,062 V1639A probably damaging Het
Srrm4 A G 5: 116,482,378 probably benign Het
Tbc1d23 G A 16: 57,189,273 H418Y probably damaging Het
Tbk1 A G 10: 121,584,254 L10P probably damaging Het
Thumpd3 G A 6: 113,065,660 probably null Het
Trp53bp1 G T 2: 121,204,943 T1609K probably damaging Het
Urb1 C T 16: 90,796,399 G282R probably damaging Het
Usp19 A T 9: 108,499,711 D1160V probably damaging Het
Usp9y A G Y: 1,316,933 V1872A probably damaging Het
Zfp276 C A 8: 123,259,503 Y386* probably null Het
Other mutations in Tut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Tut1 APN 19 8959096 missense probably damaging 1.00
IGL01934:Tut1 APN 19 8953991 missense probably damaging 1.00
IGL01980:Tut1 APN 19 8954000 missense probably damaging 1.00
IGL02115:Tut1 APN 19 8965312 missense probably damaging 1.00
IGL02375:Tut1 APN 19 8964039 missense probably damaging 1.00
IGL02683:Tut1 APN 19 8965258 missense probably benign 0.31
IGL02899:Tut1 APN 19 8962387 missense probably damaging 1.00
IGL02953:Tut1 APN 19 8962692 missense probably damaging 1.00
PIT4280001:Tut1 UTSW 19 8959262 missense probably benign 0.00
R0014:Tut1 UTSW 19 8962447 missense possibly damaging 0.61
R0014:Tut1 UTSW 19 8962447 missense possibly damaging 0.61
R0033:Tut1 UTSW 19 8962759 missense probably benign 0.03
R0091:Tut1 UTSW 19 8965436 missense probably damaging 0.97
R0173:Tut1 UTSW 19 8965483 nonsense probably null
R0362:Tut1 UTSW 19 8955527 missense possibly damaging 0.94
R0371:Tut1 UTSW 19 8962773 missense probably damaging 0.98
R1022:Tut1 UTSW 19 8959355 missense probably benign
R1024:Tut1 UTSW 19 8959355 missense probably benign
R1539:Tut1 UTSW 19 8965486 missense probably benign 0.02
R1921:Tut1 UTSW 19 8966102 missense probably benign
R1958:Tut1 UTSW 19 8959313 missense probably damaging 1.00
R2508:Tut1 UTSW 19 8955567 missense probably damaging 0.98
R4757:Tut1 UTSW 19 8959308 missense possibly damaging 0.83
R5104:Tut1 UTSW 19 8959334 missense probably benign 0.03
R5185:Tut1 UTSW 19 8955450 missense probably benign 0.07
R6999:Tut1 UTSW 19 8966018 missense probably damaging 1.00
R7084:Tut1 UTSW 19 8965414 missense probably benign
R7091:Tut1 UTSW 19 8965811 missense probably benign
R7313:Tut1 UTSW 19 8964049 missense probably benign 0.00
R7361:Tut1 UTSW 19 8965334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACCCTTTGTCGTTGAAGGAAC -3'
(R):5'- AAGGTGTCAGAAGCTCACCAACTG -3'

Sequencing Primer
(F):5'- TGTCCATATGTACAGAGCAGAGC -3'
(R):5'- CACCAACTGAGCTACTTAATGTTCTG -3'
Posted On2013-04-24