Incidental Mutation 'R4029:Dmrt2'
ID313144
Institutional Source Beutler Lab
Gene Symbol Dmrt2
Ensembl Gene ENSMUSG00000048138
Gene Namedoublesex and mab-3 related transcription factor 2
SynonymsTerra
MMRRC Submission 040959-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4029 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location25672420-25679010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 25678134 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 366 (S366A)
Ref Sequence ENSEMBL: ENSMUSP00000059654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053068]
Predicted Effect probably damaging
Transcript: ENSMUST00000053068
AA Change: S366A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059654
Gene: ENSMUSG00000048138
AA Change: S366A

DomainStartEndE-ValueType
low complexity region 38 74 N/A INTRINSIC
low complexity region 78 115 N/A INTRINSIC
DM 119 172 5.2e-28 SMART
low complexity region 224 229 N/A INTRINSIC
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DMRT gene family, sharing a DM DNA-binding domain with Drosophila 'doublesex' (dsx) and C. elegans mab3, genes involved in sex determination in these organisms. Also, this gene is located in a region of the human genome (chromosome 9p24.3) associated with gonadal dysgenesis and XY sex reversal. Hence this gene is one of the candidates for sex-determining gene(s) on chr 9. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display perinatal lethality due to breathing difficulties, multiple axial skeletal defects including kinked tails and rib and vertebral malformations, and abnormal somite organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,693,785 K46R probably benign Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp9a A T 2: 168,689,325 I174N probably damaging Het
Bfsp1 G A 2: 143,831,829 probably benign Het
Cenpq T C 17: 40,927,249 T125A probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dip2b A G 15: 100,186,172 Y892C probably damaging Het
Exoc7 C T 11: 116,306,988 probably benign Het
Fam129a G A 1: 151,695,690 V239I probably benign Het
Fam159a G T 4: 108,383,215 C43* probably null Het
Gabra4 G T 5: 71,572,189 T390K probably benign Het
Gm13101 T A 4: 143,965,784 T216S probably benign Het
Gpr68 A G 12: 100,879,216 L23P probably damaging Het
Krt17 T A 11: 100,257,523 N364I probably damaging Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Ly6g6d T A 17: 35,071,660 Q98L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nck2 T C 1: 43,554,091 F153L probably benign Het
Nme4 T C 17: 26,094,222 probably null Het
Nup35 A G 2: 80,652,974 D172G probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Oog4 A T 4: 143,440,200 N11K probably benign Het
Phlpp1 T A 1: 106,392,549 S1425T probably damaging Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Pld2 A G 11: 70,554,905 N655S probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Ston2 T C 12: 91,648,263 Q457R possibly damaging Het
Syt10 T C 15: 89,814,538 E201G probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Other mutations in Dmrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Dmrt2 APN 19 25678134 missense probably damaging 1.00
IGL02269:Dmrt2 APN 19 25678459 missense probably benign 0.01
IGL02740:Dmrt2 APN 19 25678473 missense possibly damaging 0.84
R0141:Dmrt2 UTSW 19 25678291 missense possibly damaging 0.52
R0294:Dmrt2 UTSW 19 25678071 missense probably damaging 1.00
R0352:Dmrt2 UTSW 19 25678662 missense probably damaging 1.00
R0514:Dmrt2 UTSW 19 25675655 critical splice donor site probably null
R1016:Dmrt2 UTSW 19 25675574 missense probably damaging 0.99
R1104:Dmrt2 UTSW 19 25678616 missense probably benign 0.01
R1164:Dmrt2 UTSW 19 25677993 missense possibly damaging 0.89
R1467:Dmrt2 UTSW 19 25673606 missense possibly damaging 0.72
R1467:Dmrt2 UTSW 19 25673606 missense possibly damaging 0.72
R3107:Dmrt2 UTSW 19 25677691 missense probably benign 0.01
R3109:Dmrt2 UTSW 19 25677691 missense probably benign 0.01
R4841:Dmrt2 UTSW 19 25677667 missense probably damaging 1.00
R5317:Dmrt2 UTSW 19 25673480 missense probably benign 0.00
R6335:Dmrt2 UTSW 19 25673571 missense possibly damaging 0.73
R6554:Dmrt2 UTSW 19 25677948 missense probably damaging 1.00
R6752:Dmrt2 UTSW 19 25678342 missense probably damaging 0.96
X0058:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
X0060:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
X0063:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
Z1088:Dmrt2 UTSW 19 25678642 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCACCATGCAGTATTCAGGG -3'
(R):5'- GGCAGTCCATATCAACAATGGG -3'

Sequencing Primer
(F):5'- ACCATGCAGTATTCAGGGTCTGG -3'
(R):5'- AGGCAGACCTCTCTGGAAC -3'
Posted On2015-04-30