Incidental Mutation 'R0387:Atg4b'
ID31318
Institutional Source Beutler Lab
Gene Symbol Atg4b
Ensembl Gene ENSMUSG00000026280
Gene Nameautophagy related 4B, cysteine peptidase
Synonyms2510009N07Rik, autophagin 1, Apg4b
MMRRC Submission 038593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R0387 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93751500-93790610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93786556 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 354 (Q354K)
Ref Sequence ENSEMBL: ENSMUSP00000027502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027502] [ENSMUST00000185482] [ENSMUST00000186811]
Predicted Effect probably benign
Transcript: ENSMUST00000027502
AA Change: Q354K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027502
Gene: ENSMUSG00000026280
AA Change: Q354K

DomainStartEndE-ValueType
Pfam:Peptidase_C54 39 335 4.4e-104 PFAM
low complexity region 375 393 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135762
Predicted Effect probably benign
Transcript: ENSMUST00000185482
SMART Domains Protein: ENSMUSP00000140758
Gene: ENSMUSG00000026280

DomainStartEndE-ValueType
Pfam:Peptidase_C54 36 137 2.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186124
Predicted Effect probably benign
Transcript: ENSMUST00000186811
SMART Domains Protein: ENSMUSP00000139463
Gene: ENSMUSG00000026280

DomainStartEndE-ValueType
Pfam:Peptidase_C54 2 52 6.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189872
Meta Mutation Damage Score 0.1492 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased autophagy, impaired swimming, circling, head tilting, and abnormal utricle, saccular, and otolith morphology. Mice homozygous for another gene trap allele exhibit partial preweaning lethality and impaired motor coordination and learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,332,852 probably null Het
Abcc9 T A 6: 142,639,504 K825* probably null Het
Afp T C 5: 90,497,291 C189R probably damaging Het
Akap9 T C 5: 3,951,678 probably benign Het
Alpk3 A T 7: 81,104,227 T1652S possibly damaging Het
Atxn2 T C 5: 121,802,143 S388P possibly damaging Het
C2cd3 T A 7: 100,422,507 probably benign Het
Cacna2d2 C A 9: 107,513,881 T403K probably damaging Het
Cap2 C T 13: 46,560,516 H79Y probably damaging Het
Car10 G T 11: 93,583,021 probably null Het
Ccno T C 13: 112,989,867 L290P probably damaging Het
Cfap69 T C 5: 5,589,303 K624E probably damaging Het
Ctnna3 A G 10: 64,586,130 M568V probably benign Het
Cyp1b1 C A 17: 79,713,774 V180L probably benign Het
Cyp2u1 G T 3: 131,295,552 probably null Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnm1 C T 2: 32,320,581 G1S possibly damaging Het
Dnmt1 A G 9: 20,918,213 L698P probably damaging Het
Dock10 C A 1: 80,540,276 C1327F probably damaging Het
Dph3b-ps A G 13: 106,546,855 noncoding transcript Het
Dpyd G A 3: 119,427,226 D949N probably benign Het
Dync2li1 A G 17: 84,655,340 K345E possibly damaging Het
Eml2 T A 7: 19,182,259 probably null Het
Exoc7 A G 11: 116,294,401 probably benign Het
Faah A T 4: 116,005,692 C113* probably null Het
Fcf1 T A 12: 84,973,002 D16E probably benign Het
Fcgbp T C 7: 28,091,454 probably benign Het
Ghr A G 15: 3,319,891 S602P probably benign Het
Gm10334 A G 6: 41,443,369 I141T possibly damaging Het
Gm5114 T C 7: 39,408,809 D462G probably benign Het
Gm8186 T A 17: 26,099,026 S66C probably damaging Het
Gorab C T 1: 163,396,834 V133M probably benign Het
Gria1 G A 11: 57,309,884 probably null Het
Grik1 T A 16: 88,034,350 probably benign Het
Gtf3c1 A G 7: 125,681,104 L378P probably damaging Het
Htr5b A T 1: 121,527,546 V215D probably damaging Het
Htra1 A G 7: 130,979,478 T319A probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klrb1a A C 6: 128,609,734 H189Q possibly damaging Het
Lhfp A G 3: 53,043,328 T8A probably benign Het
Ly75 T A 2: 60,306,404 Y1493F probably benign Het
Mfsd5 T C 15: 102,281,096 I301T possibly damaging Het
Mlkl C T 8: 111,333,350 E135K probably damaging Het
Mrgprx2 A C 7: 48,499,160 M1R probably null Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Mtbp A G 15: 55,611,029 I280V possibly damaging Het
Myo5c A T 9: 75,285,021 probably benign Het
Nos3 A G 5: 24,367,585 K174R probably damaging Het
Oas2 A T 5: 120,745,672 probably benign Het
Olfr889 T A 9: 38,115,770 probably null Het
Pi4kb G C 3: 94,984,740 E256Q probably benign Het
Pik3c2a T A 7: 116,373,744 I739F probably damaging Het
Pla2r1 T A 2: 60,432,601 K1031N probably benign Het
Plk4 A T 3: 40,812,884 probably benign Het
Polq T C 16: 37,029,430 C349R probably damaging Het
Polq G T 16: 37,089,317 E2354D probably damaging Het
Prss22 A G 17: 23,993,929 L278P probably damaging Het
Ptprk G A 10: 28,354,629 V239I possibly damaging Het
Raph1 T G 1: 60,510,496 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor3 C T 2: 167,983,772 W755* probably null Het
Rnd3 G T 2: 51,148,231 D77E probably damaging Het
Ryr1 T C 7: 29,083,367 probably benign Het
Serpinb1a C T 13: 32,848,738 V63I probably benign Het
Six1 T G 12: 73,046,041 Y129S probably damaging Het
Spata31d1a G A 13: 59,703,501 T271I probably damaging Het
Stab1 T C 14: 31,148,101 D1387G probably benign Het
Stra6 T A 9: 58,153,183 M625K probably benign Het
Syne1 T C 10: 5,351,029 S900G probably benign Het
Tdpoz4 A C 3: 93,796,700 K101N probably benign Het
Tigd2 T C 6: 59,211,158 Y337H probably benign Het
Tnxb A G 17: 34,683,574 I1134V probably benign Het
Tspyl5 A G 15: 33,686,935 I288T probably damaging Het
Ulk1 A G 5: 110,788,797 V61A possibly damaging Het
Xxylt1 A G 16: 30,957,376 Y381H probably benign Het
Zcchc9 T A 13: 91,800,947 M12L probably benign Het
Zfp106 T C 2: 120,528,472 probably null Het
Zfp74 T A 7: 29,934,754 T510S probably benign Het
Zfp808 A G 13: 62,169,478 T14A probably damaging Het
Other mutations in Atg4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Atg4b APN 1 93785904 splice site probably benign
IGL01875:Atg4b APN 1 93778310 missense probably damaging 1.00
IGL02884:Atg4b APN 1 93787715 utr 3 prime probably benign
R0050:Atg4b UTSW 1 93787718 utr 3 prime probably benign
R0050:Atg4b UTSW 1 93787718 utr 3 prime probably benign
R0533:Atg4b UTSW 1 93784910 splice site probably benign
R2382:Atg4b UTSW 1 93784842 missense probably damaging 1.00
R3113:Atg4b UTSW 1 93775704 splice site probably benign
R3730:Atg4b UTSW 1 93768275 missense probably damaging 0.99
R4303:Atg4b UTSW 1 93768262 missense probably benign 0.02
R4612:Atg4b UTSW 1 93786541 missense probably damaging 1.00
R5027:Atg4b UTSW 1 93786575 missense probably benign 0.00
R5048:Atg4b UTSW 1 93775658 missense possibly damaging 0.75
R5427:Atg4b UTSW 1 93775206 missense probably damaging 1.00
R5735:Atg4b UTSW 1 93773797 missense probably damaging 1.00
R7209:Atg4b UTSW 1 93775233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGATCTTACTAGTTGGGCAGGC -3'
(R):5'- ATCCCCATTGGCTCTTAGACGGAC -3'

Sequencing Primer
(F):5'- GCCTGTGCTGTGTTGATCAC -3'
(R):5'- TTGCACCTGGGCCTCAAATAG -3'
Posted On2013-04-24