Incidental Mutation 'R4021:Krit1'
ID313228
Institutional Source Beutler Lab
Gene Symbol Krit1
Ensembl Gene ENSMUSG00000000600
Gene NameKRIT1, ankyrin repeat containing
SynonymsKrit1B, A630036P20Rik, Krit1, Krit1A, Ccm1, 2010007K12Rik
MMRRC Submission 040955-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4021 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location3803184-3845564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3832132 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 596 (I596K)
Ref Sequence ENSEMBL: ENSMUSP00000143559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080085] [ENSMUST00000171023] [ENSMUST00000200386] [ENSMUST00000200577]
Predicted Effect probably benign
Transcript: ENSMUST00000080085
AA Change: I644K

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078985
Gene: ENSMUSG00000000600
AA Change: I644K

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 3.8e-88 PFAM
ANK 287 316 1.04e2 SMART
ANK 320 350 4.5e-3 SMART
ANK 354 382 1.17e-1 SMART
B41 416 640 1.39e-39 SMART
Blast:B41 673 702 6e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171023
AA Change: I644K

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132375
Gene: ENSMUSG00000000600
AA Change: I644K

DomainStartEndE-ValueType
PDB:4DX8|K 1 198 1e-125 PDB
ANK 287 316 1.04e2 SMART
ANK 320 350 4.5e-3 SMART
ANK 354 382 1.17e-1 SMART
B41 416 640 1.39e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200004
Predicted Effect probably benign
Transcript: ENSMUST00000200386
AA Change: I596K

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143559
Gene: ENSMUSG00000000600
AA Change: I596K

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 8.1e-85 PFAM
ANK 306 334 7.5e-4 SMART
B41 368 592 9.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200577
SMART Domains Protein: ENSMUSP00000143776
Gene: ENSMUSG00000000600

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 1.8e-85 PFAM
Blast:B41 200 329 1e-82 BLAST
SCOP:d1ycsb1 291 329 2e-8 SMART
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing four ankyrin repeats, a band 4.1/ezrin/radixin/moesin (FERM) domain, and multiple NPXY sequences. The encoded protein is localized in the nucleus and cytoplasm. It binds to integrin cytoplasmic domain-associated protein-1 alpha (ICAP1alpha), and plays a critical role in beta1-integrin-mediated cell proliferation. It associates with junction proteins and RAS-related protein 1A (Rap1A), which requires the encoded protein for maintaining the integrity of endothelial junctions. It is also a microtubule-associated protein and may play a role in microtubule targeting. Mutations in this gene result in cerebral cavernous malformations. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Targeted disruption of this gene results in embryonic lethality by E11. Embryos display prominent vascular defects that disrupt arterial modeling and phenocopy the human disorder of cerebral cavernous malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 L102P probably benign Het
Adcy4 C T 14: 55,775,178 probably null Het
Adgrf5 A T 17: 43,430,714 probably benign Het
Atp11a A G 8: 12,842,938 K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 T428M probably damaging Het
Cdh22 T C 2: 165,143,673 D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 probably null Het
Csnk2a1 C T 2: 152,258,689 T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Dock7 T C 4: 99,003,920 probably null Het
Dock9 T C 14: 121,626,912 K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fam107b G A 2: 3,778,474 R238Q probably damaging Het
Fam186a G C 15: 99,941,799 T2188S possibly damaging Het
Farsa A G 8: 84,868,870 T465A probably damaging Het
Fibp T C 19: 5,460,734 probably null Het
Flywch2 G A 17: 23,777,039 T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 D49V probably damaging Het
Fstl5 A G 3: 76,628,975 T31A probably benign Het
Gabbr2 G A 4: 46,846,435 T158I probably damaging Het
Gbp4 T A 5: 105,120,923 R455W probably damaging Het
Gm11492 A G 11: 87,567,280 E160G probably damaging Het
Got2 T G 8: 95,877,753 D69A probably damaging Het
Gpr63 T C 4: 25,008,470 F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 M186V probably benign Het
Haus2 A T 2: 120,615,930 Q111L probably damaging Het
Hexdc T C 11: 121,218,161 probably null Het
Igf2r T A 17: 12,748,751 N27I probably damaging Het
Itgax T A 7: 128,133,139 probably null Het
Lair1 A G 7: 4,055,916 probably null Het
Lilra6 G T 7: 3,911,418 T276K probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 E3406K probably damaging Het
Myo15b A G 11: 115,873,505 H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 F681L probably benign Het
Olfr1157 T A 2: 87,962,722 T57S possibly damaging Het
Olfr703 T A 7: 106,845,019 M136K probably damaging Het
Pear1 T C 3: 87,756,222 N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Sag A T 1: 87,821,305 probably null Het
Slc22a2 T C 17: 12,584,489 L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Taar7a G T 10: 23,993,386 N32K probably benign Het
Tbck C A 3: 132,727,134 T435K probably damaging Het
Tril T G 6: 53,819,019 D406A probably damaging Het
Tshz2 G A 2: 169,885,862 D324N probably damaging Het
Vps13d A G 4: 145,075,061 V2349A possibly damaging Het
Wdr6 A G 9: 108,575,206 W493R probably damaging Het
Wdr72 G A 9: 74,151,593 V323I probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Zic4 A G 9: 91,379,036 T108A probably benign Het
Znrf3 T C 11: 5,281,278 D745G possibly damaging Het
Other mutations in Krit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Krit1 APN 5 3812844 missense probably damaging 0.98
IGL02186:Krit1 APN 5 3809733 splice site probably benign
IGL02526:Krit1 APN 5 3822103 missense probably damaging 1.00
IGL03280:Krit1 APN 5 3811248 splice site probably benign
IGL03385:Krit1 APN 5 3807452 missense possibly damaging 0.51
Waspish UTSW 5 3831551 missense probably damaging 1.00
R0127:Krit1 UTSW 5 3822178 missense probably damaging 0.99
R0594:Krit1 UTSW 5 3823694 missense possibly damaging 0.71
R1157:Krit1 UTSW 5 3832176 missense probably damaging 1.00
R1777:Krit1 UTSW 5 3836799 missense probably damaging 0.96
R2115:Krit1 UTSW 5 3822108 nonsense probably null
R4041:Krit1 UTSW 5 3809642 missense probably damaging 1.00
R4786:Krit1 UTSW 5 3812467 missense possibly damaging 0.86
R4989:Krit1 UTSW 5 3822238 missense probably damaging 1.00
R5217:Krit1 UTSW 5 3806451 nonsense probably null
R5304:Krit1 UTSW 5 3819326 missense probably damaging 0.99
R5371:Krit1 UTSW 5 3831551 missense probably damaging 1.00
R5682:Krit1 UTSW 5 3830737 missense probably damaging 0.99
R6248:Krit1 UTSW 5 3813032 intron probably null
R6338:Krit1 UTSW 5 3836857 missense probably benign 0.01
R7081:Krit1 UTSW 5 3823651 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CACTTGGGATAATATACCGTGACTTC -3'
(R):5'- CATTTCTAGATTCTTCAAGGAAGACGG -3'

Sequencing Primer
(F):5'- GGGACATTGATTTTAGAAATGGCTAG -3'
(R):5'- CGGAGAAGCTATTCTAAACAATACG -3'
Posted On2015-04-30