Incidental Mutation 'R4021:Cacna2d2'
ID313246
Institutional Source Beutler Lab
Gene Symbol Cacna2d2
Ensembl Gene ENSMUSG00000010066
Gene Namecalcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonymsa2d2
MMRRC Submission 040955-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R4021 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107399612-107529343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107514058 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 428 (T428M)
Ref Sequence ENSEMBL: ENSMUSP00000125943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010210] [ENSMUST00000085092] [ENSMUST00000164988] [ENSMUST00000166799] [ENSMUST00000168532] [ENSMUST00000170737]
Predicted Effect probably damaging
Transcript: ENSMUST00000010210
AA Change: T428M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010210
Gene: ENSMUSG00000010066
AA Change: T428M

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 9.9e-32 PFAM
Pfam:VGCC_alpha2 583 673 1.8e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085092
AA Change: T428M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082173
Gene: ENSMUSG00000010066
AA Change: T428M

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164988
AA Change: T428M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130451
Gene: ENSMUSG00000010066
AA Change: T428M

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 6.7e-49 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 2.4e-31 PFAM
Pfam:VGCC_alpha2 583 675 2.5e-34 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166799
AA Change: T428M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126029
Gene: ENSMUSG00000010066
AA Change: T428M

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 8.5e-44 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 576 1.3e-32 PFAM
Pfam:VGCC_alpha2 583 675 1.4e-47 PFAM
low complexity region 975 984 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168532
AA Change: T428M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132512
Gene: ENSMUSG00000010066
AA Change: T428M

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2.1e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1122 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169354
Predicted Effect probably damaging
Transcript: ENSMUST00000170737
AA Change: T428M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125943
Gene: ENSMUSG00000010066
AA Change: T428M

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 673 1.9e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1116 1139 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171809
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for different mutant alleles show variable movement abnormalities including waddling, reeling or very slow gait, ataxia, and mild spike-wave seizures. While gross CNS abnormalities and demyelination are present in some mutant lines, they are not observed in others. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 L102P probably benign Het
Adcy4 C T 14: 55,775,178 probably null Het
Adgrf5 A T 17: 43,430,714 probably benign Het
Atp11a A G 8: 12,842,938 K643R probably benign Het
Cdh22 T C 2: 165,143,673 D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 probably null Het
Csnk2a1 C T 2: 152,258,689 T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Dock7 T C 4: 99,003,920 probably null Het
Dock9 T C 14: 121,626,912 K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fam107b G A 2: 3,778,474 R238Q probably damaging Het
Fam186a G C 15: 99,941,799 T2188S possibly damaging Het
Farsa A G 8: 84,868,870 T465A probably damaging Het
Fibp T C 19: 5,460,734 probably null Het
Flywch2 G A 17: 23,777,039 T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 D49V probably damaging Het
Fstl5 A G 3: 76,628,975 T31A probably benign Het
Gabbr2 G A 4: 46,846,435 T158I probably damaging Het
Gbp4 T A 5: 105,120,923 R455W probably damaging Het
Gm11492 A G 11: 87,567,280 E160G probably damaging Het
Got2 T G 8: 95,877,753 D69A probably damaging Het
Gpr63 T C 4: 25,008,470 F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 M186V probably benign Het
Haus2 A T 2: 120,615,930 Q111L probably damaging Het
Hexdc T C 11: 121,218,161 probably null Het
Igf2r T A 17: 12,748,751 N27I probably damaging Het
Itgax T A 7: 128,133,139 probably null Het
Krit1 T A 5: 3,832,132 I596K probably benign Het
Lair1 A G 7: 4,055,916 probably null Het
Lilra6 G T 7: 3,911,418 T276K probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 E3406K probably damaging Het
Myo15b A G 11: 115,873,505 H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 F681L probably benign Het
Olfr1157 T A 2: 87,962,722 T57S possibly damaging Het
Olfr703 T A 7: 106,845,019 M136K probably damaging Het
Pear1 T C 3: 87,756,222 N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Sag A T 1: 87,821,305 probably null Het
Slc22a2 T C 17: 12,584,489 L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Taar7a G T 10: 23,993,386 N32K probably benign Het
Tbck C A 3: 132,727,134 T435K probably damaging Het
Tril T G 6: 53,819,019 D406A probably damaging Het
Tshz2 G A 2: 169,885,862 D324N probably damaging Het
Vps13d A G 4: 145,075,061 V2349A possibly damaging Het
Wdr6 A G 9: 108,575,206 W493R probably damaging Het
Wdr72 G A 9: 74,151,593 V323I probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Zic4 A G 9: 91,379,036 T108A probably benign Het
Znrf3 T C 11: 5,281,278 D745G possibly damaging Het
Other mutations in Cacna2d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Cacna2d2 APN 9 107514873 missense probably damaging 1.00
IGL00425:Cacna2d2 APN 9 107527351 missense probably damaging 1.00
IGL01294:Cacna2d2 APN 9 107514081 missense probably damaging 1.00
IGL01969:Cacna2d2 APN 9 107509216 missense probably benign
IGL01974:Cacna2d2 APN 9 107517422 missense probably benign 0.00
IGL02001:Cacna2d2 APN 9 107522116 missense probably benign
IGL02125:Cacna2d2 APN 9 107513904 nonsense probably null
IGL02143:Cacna2d2 APN 9 107518275 splice site probably null
IGL02150:Cacna2d2 APN 9 107527316 splice site probably benign
IGL02213:Cacna2d2 APN 9 107514048 missense probably damaging 1.00
IGL02220:Cacna2d2 APN 9 107514879 missense probably damaging 1.00
IGL02238:Cacna2d2 APN 9 107513558 missense probably damaging 0.99
IGL02466:Cacna2d2 APN 9 107465554 missense probably damaging 1.00
IGL02569:Cacna2d2 APN 9 107514046 missense probably damaging 0.99
IGL02571:Cacna2d2 APN 9 107525646 missense possibly damaging 0.93
IGL02825:Cacna2d2 APN 9 107524460 missense probably damaging 1.00
IGL03000:Cacna2d2 APN 9 107524198 splice site probably null
IGL03064:Cacna2d2 APN 9 107509275 missense probably damaging 1.00
Blow UTSW 9 107513606 missense probably null 0.90
hera UTSW 9 107513280 missense probably damaging 1.00
PIT4131001:Cacna2d2 UTSW 9 107524668 missense probably damaging 1.00
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0387:Cacna2d2 UTSW 9 107513881 missense probably damaging 1.00
R0410:Cacna2d2 UTSW 9 107524620 missense probably damaging 1.00
R0538:Cacna2d2 UTSW 9 107524383 splice site probably benign
R0545:Cacna2d2 UTSW 9 107525223 missense probably damaging 1.00
R0729:Cacna2d2 UTSW 9 107517257 missense probably benign 0.06
R1024:Cacna2d2 UTSW 9 107527050 critical splice donor site probably null
R1538:Cacna2d2 UTSW 9 107517416 missense probably damaging 1.00
R1750:Cacna2d2 UTSW 9 107524644 missense probably damaging 1.00
R1774:Cacna2d2 UTSW 9 107526151 missense probably benign 0.19
R1800:Cacna2d2 UTSW 9 107527433 missense possibly damaging 0.46
R1873:Cacna2d2 UTSW 9 107513872 missense probably damaging 0.98
R1935:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1936:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1971:Cacna2d2 UTSW 9 107512006 missense probably damaging 0.98
R2095:Cacna2d2 UTSW 9 107527165 missense probably benign 0.05
R2135:Cacna2d2 UTSW 9 107526513 missense possibly damaging 0.74
R2197:Cacna2d2 UTSW 9 107527403 missense probably damaging 0.97
R2266:Cacna2d2 UTSW 9 107513280 missense probably damaging 1.00
R2483:Cacna2d2 UTSW 9 107512022 missense probably damaging 1.00
R4392:Cacna2d2 UTSW 9 107400280 missense possibly damaging 0.47
R4629:Cacna2d2 UTSW 9 107527322 missense probably damaging 1.00
R5053:Cacna2d2 UTSW 9 107514864 missense probably damaging 1.00
R5327:Cacna2d2 UTSW 9 107513606 missense probably null 0.90
R5347:Cacna2d2 UTSW 9 107514114 missense probably benign
R5719:Cacna2d2 UTSW 9 107524652 missense probably benign 0.36
R5737:Cacna2d2 UTSW 9 107526747 missense possibly damaging 0.70
R5739:Cacna2d2 UTSW 9 107512329 missense probably benign 0.37
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6084:Cacna2d2 UTSW 9 107497521 critical splice donor site probably null
R6170:Cacna2d2 UTSW 9 107527334 missense probably damaging 1.00
R6254:Cacna2d2 UTSW 9 107509216 missense probably benign
R6427:Cacna2d2 UTSW 9 107515442 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ATCATGATGTTCACGGATGGGG -3'
(R):5'- TGGTCAAGCAAGACAGCCC -3'

Sequencing Primer
(F):5'- GGTGAGGATCGCGTGCAG -3'
(R):5'- CACCGGAAAAAGGGTATGTATG -3'
Posted On2015-04-30