Incidental Mutation 'R4021:Myo15b'
ID313253
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Namemyosin XVB
SynonymsLOC217328, E330039G21Rik, LOC380737
MMRRC Submission 040955-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4021 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115858406-115892603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115873505 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1315 (H1315R)
Ref Sequence ENSEMBL: ENSMUSP00000091439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093911] [ENSMUST00000222123]
Predicted Effect probably benign
Transcript: ENSMUST00000093911
AA Change: H1315R

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427
AA Change: H1315R

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151507
Predicted Effect probably benign
Transcript: ENSMUST00000222123
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 L102P probably benign Het
Adcy4 C T 14: 55,775,178 probably null Het
Adgrf5 A T 17: 43,430,714 probably benign Het
Atp11a A G 8: 12,842,938 K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 T428M probably damaging Het
Cdh22 T C 2: 165,143,673 D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 probably null Het
Csnk2a1 C T 2: 152,258,689 T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Dock7 T C 4: 99,003,920 probably null Het
Dock9 T C 14: 121,626,912 K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fam107b G A 2: 3,778,474 R238Q probably damaging Het
Fam186a G C 15: 99,941,799 T2188S possibly damaging Het
Farsa A G 8: 84,868,870 T465A probably damaging Het
Fibp T C 19: 5,460,734 probably null Het
Flywch2 G A 17: 23,777,039 T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 D49V probably damaging Het
Fstl5 A G 3: 76,628,975 T31A probably benign Het
Gabbr2 G A 4: 46,846,435 T158I probably damaging Het
Gbp4 T A 5: 105,120,923 R455W probably damaging Het
Gm11492 A G 11: 87,567,280 E160G probably damaging Het
Got2 T G 8: 95,877,753 D69A probably damaging Het
Gpr63 T C 4: 25,008,470 F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 M186V probably benign Het
Haus2 A T 2: 120,615,930 Q111L probably damaging Het
Hexdc T C 11: 121,218,161 probably null Het
Igf2r T A 17: 12,748,751 N27I probably damaging Het
Itgax T A 7: 128,133,139 probably null Het
Krit1 T A 5: 3,832,132 I596K probably benign Het
Lair1 A G 7: 4,055,916 probably null Het
Lilra6 G T 7: 3,911,418 T276K probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 E3406K probably damaging Het
Nlrp2 A G 7: 5,325,012 F681L probably benign Het
Olfr1157 T A 2: 87,962,722 T57S possibly damaging Het
Olfr703 T A 7: 106,845,019 M136K probably damaging Het
Pear1 T C 3: 87,756,222 N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Sag A T 1: 87,821,305 probably null Het
Slc22a2 T C 17: 12,584,489 L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Taar7a G T 10: 23,993,386 N32K probably benign Het
Tbck C A 3: 132,727,134 T435K probably damaging Het
Tril T G 6: 53,819,019 D406A probably damaging Het
Tshz2 G A 2: 169,885,862 D324N probably damaging Het
Vps13d A G 4: 145,075,061 V2349A possibly damaging Het
Wdr6 A G 9: 108,575,206 W493R probably damaging Het
Wdr72 G A 9: 74,151,593 V323I probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Zic4 A G 9: 91,379,036 T108A probably benign Het
Znrf3 T C 11: 5,281,278 D745G possibly damaging Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115891916 missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115869504 nonsense probably null
IGL01539:Myo15b APN 11 115863473 missense probably benign 0.43
IGL01895:Myo15b APN 11 115883498 missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115886283 missense probably damaging 1.00
IGL02343:Myo15b APN 11 115873400 unclassified probably benign
IGL02349:Myo15b APN 11 115863105 splice site probably benign
IGL02368:Myo15b APN 11 115877002 missense probably benign 0.13
IGL02576:Myo15b APN 11 115890053 missense probably null 0.97
IGL02650:Myo15b APN 11 115886511 critical splice donor site probably null
IGL02661:Myo15b APN 11 115884069 missense probably benign 0.01
IGL02716:Myo15b APN 11 115883709 missense probably benign 0.06
IGL02733:Myo15b APN 11 115884250 missense probably benign 0.00
IGL02951:Myo15b APN 11 115881301 missense probably damaging 1.00
IGL03017:Myo15b APN 11 115887917 missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115871643 missense probably benign 0.08
ANU74:Myo15b UTSW 11 115878413 missense probably damaging 1.00
R0092:Myo15b UTSW 11 115862986 missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115886283 missense probably damaging 1.00
R0325:Myo15b UTSW 11 115884265 missense probably damaging 1.00
R0614:Myo15b UTSW 11 115882913 missense probably damaging 1.00
R0652:Myo15b UTSW 11 115864642 missense probably benign 0.07
R0711:Myo15b UTSW 11 115883838 missense probably damaging 1.00
R0815:Myo15b UTSW 11 115866336 splice site probably benign
R0961:Myo15b UTSW 11 115882454 missense probably benign 0.15
R1066:Myo15b UTSW 11 115879751 missense probably benign 0.03
R1221:Myo15b UTSW 11 115886720 missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115880501 missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115883492 small deletion probably benign
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1317:Myo15b UTSW 11 115883634 missense probably null 0.14
R1491:Myo15b UTSW 11 115886857 splice site probably null
R1552:Myo15b UTSW 11 115866635 missense probably benign 0.08
R1731:Myo15b UTSW 11 115891560 missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115880509 critical splice donor site probably null
R1843:Myo15b UTSW 11 115869586 missense probably benign 0.04
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1894:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1917:Myo15b UTSW 11 115882254 missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115863484 missense probably benign 0.30
R1939:Myo15b UTSW 11 115887703 missense probably benign 0.00
R1945:Myo15b UTSW 11 115878398 missense probably damaging 1.00
R1986:Myo15b UTSW 11 115882875 missense probably benign 0.31
R2130:Myo15b UTSW 11 115871643 missense probably benign 0.08
R2138:Myo15b UTSW 11 115883807 missense probably benign 0.00
R2176:Myo15b UTSW 11 115866572 missense probably damaging 1.00
R2415:Myo15b UTSW 11 115879564 missense probably benign 0.00
R2483:Myo15b UTSW 11 115864739 missense probably benign 0.04
R3620:Myo15b UTSW 11 115871187 missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115863413 missense probably benign 0.01
R4013:Myo15b UTSW 11 115871456 nonsense probably null
R4119:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4120:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4499:Myo15b UTSW 11 115890952 missense probably benign 0.00
R4653:Myo15b UTSW 11 115879987 critical splice donor site probably null
R4655:Myo15b UTSW 11 115890697 missense probably damaging 1.00
R4700:Myo15b UTSW 11 115861935 missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115884008 missense probably benign 0.01
R4777:Myo15b UTSW 11 115879652 missense probably damaging 0.99
R4833:Myo15b UTSW 11 115887602 missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115866656 missense probably benign 0.01
R5121:Myo15b UTSW 11 115886054 missense probably damaging 1.00
R5146:Myo15b UTSW 11 115891198 missense probably benign 0.00
R5535:Myo15b UTSW 11 115881301 missense probably damaging 1.00
R5647:Myo15b UTSW 11 115871511 missense probably damaging 0.99
R5849:Myo15b UTSW 11 115881933 missense probably damaging 1.00
R5882:Myo15b UTSW 11 115869596 missense probably damaging 1.00
R5956:Myo15b UTSW 11 115873757 missense probably benign 0.34
R6273:Myo15b UTSW 11 115862799 missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115886239 missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115890831 missense probably damaging 1.00
R6462:Myo15b UTSW 11 115859442 missense probably benign 0.01
R6792:Myo15b UTSW 11 115885097 missense probably damaging 1.00
X0020:Myo15b UTSW 11 115871799 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTTTGCATTCAGGTGTCAATCA -3'
(R):5'- TTTGGGAAGCAGACAGGACA -3'

Sequencing Primer
(F):5'- GCATTCAGGTGTCAATCAAGTGTC -3'
(R):5'- GGACATGCCTGCTCTTCTC -3'
Posted On2015-04-30