Incidental Mutation 'R4021:Hexdc'
ID313254
Institutional Source Beutler Lab
Gene Symbol Hexdc
Ensembl Gene ENSMUSG00000039307
Gene Namehexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Synonyms
MMRRC Submission 040955-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4021 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location121204433-121222655 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 121218161 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000038709] [ENSMUST00000038831] [ENSMUST00000106115] [ENSMUST00000106117] [ENSMUST00000106117] [ENSMUST00000124768]
Predicted Effect probably benign
Transcript: ENSMUST00000038709
SMART Domains Protein: ENSMUSP00000042277
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 187 1e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000038831
SMART Domains Protein: ENSMUSP00000048479
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 30 223 2.9e-12 PFAM
low complexity region 528 538 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106115
SMART Domains Protein: ENSMUSP00000101721
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 2 184 3e-88 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106117
SMART Domains Protein: ENSMUSP00000101723
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 31 229 1.7e-18 PFAM
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106117
SMART Domains Protein: ENSMUSP00000101723
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 31 229 1.7e-18 PFAM
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124761
SMART Domains Protein: ENSMUSP00000116406
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 20 194 6.1e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124761
SMART Domains Protein: ENSMUSP00000116406
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 20 194 6.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124768
SMART Domains Protein: ENSMUSP00000122008
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 22 152 8.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131009
Predicted Effect probably null
Transcript: ENSMUST00000151495
SMART Domains Protein: ENSMUSP00000123073
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 27 220 3.1e-12 PFAM
low complexity region 525 535 N/A INTRINSIC
Meta Mutation Damage Score 0.496 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,088 L102P probably benign Het
Adcy4 C T 14: 55,775,178 probably null Het
Adgrf5 A T 17: 43,430,714 probably benign Het
Atp11a A G 8: 12,842,938 K643R probably benign Het
Cacna2d2 C T 9: 107,514,058 T428M probably damaging Het
Cdh22 T C 2: 165,143,673 D331G possibly damaging Het
Chmp3 T C 6: 71,574,238 probably null Het
Csnk2a1 C T 2: 152,258,689 T127M probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Dock7 T C 4: 99,003,920 probably null Het
Dock9 T C 14: 121,626,912 K761E possibly damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fam107b G A 2: 3,778,474 R238Q probably damaging Het
Fam186a G C 15: 99,941,799 T2188S possibly damaging Het
Farsa A G 8: 84,868,870 T465A probably damaging Het
Fibp T C 19: 5,460,734 probably null Het
Flywch2 G A 17: 23,777,039 T128I possibly damaging Het
Foxi2 A T 7: 135,410,530 D49V probably damaging Het
Fstl5 A G 3: 76,628,975 T31A probably benign Het
Gabbr2 G A 4: 46,846,435 T158I probably damaging Het
Gbp4 T A 5: 105,120,923 R455W probably damaging Het
Gm11492 A G 11: 87,567,280 E160G probably damaging Het
Got2 T G 8: 95,877,753 D69A probably damaging Het
Gpr63 T C 4: 25,008,470 F398S possibly damaging Het
Gtf2h4 T C 17: 35,670,664 M186V probably benign Het
Haus2 A T 2: 120,615,930 Q111L probably damaging Het
Igf2r T A 17: 12,748,751 N27I probably damaging Het
Itgax T A 7: 128,133,139 probably null Het
Krit1 T A 5: 3,832,132 I596K probably benign Het
Lair1 A G 7: 4,055,916 probably null Het
Lilra6 G T 7: 3,911,418 T276K probably benign Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrgprb1 A T 7: 48,447,123 I347N possibly damaging Het
Mroh2b T A 15: 4,925,100 C682S possibly damaging Het
Mtif3 T A 5: 146,955,678 R249S possibly damaging Het
Mycbp2 C T 14: 103,152,157 E3406K probably damaging Het
Myo15b A G 11: 115,873,505 H1315R probably benign Het
Nlrp2 A G 7: 5,325,012 F681L probably benign Het
Olfr1157 T A 2: 87,962,722 T57S possibly damaging Het
Olfr703 T A 7: 106,845,019 M136K probably damaging Het
Pear1 T C 3: 87,756,222 N390D possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Sag A T 1: 87,821,305 probably null Het
Slc22a2 T C 17: 12,584,489 L70P probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Taar7a G T 10: 23,993,386 N32K probably benign Het
Tbck C A 3: 132,727,134 T435K probably damaging Het
Tril T G 6: 53,819,019 D406A probably damaging Het
Tshz2 G A 2: 169,885,862 D324N probably damaging Het
Vps13d A G 4: 145,075,061 V2349A possibly damaging Het
Wdr6 A G 9: 108,575,206 W493R probably damaging Het
Wdr72 G A 9: 74,151,593 V323I probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Zic4 A G 9: 91,379,036 T108A probably benign Het
Znrf3 T C 11: 5,281,278 D745G possibly damaging Het
Other mutations in Hexdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Hexdc APN 11 121221160 missense probably benign 0.35
IGL01981:Hexdc APN 11 121216993 missense possibly damaging 0.93
R0360:Hexdc UTSW 11 121212143 missense probably benign 0.18
R0364:Hexdc UTSW 11 121212143 missense probably benign 0.18
R0376:Hexdc UTSW 11 121218165 splice site probably benign
R1148:Hexdc UTSW 11 121221267 missense probably benign 0.09
R1148:Hexdc UTSW 11 121221267 missense probably benign 0.09
R1493:Hexdc UTSW 11 121221267 missense probably benign 0.09
R1883:Hexdc UTSW 11 121207698 missense probably benign 0.00
R4163:Hexdc UTSW 11 121221149 missense probably benign 0.01
R4939:Hexdc UTSW 11 121207716 missense probably benign
R5308:Hexdc UTSW 11 121222269 missense probably damaging 1.00
R5716:Hexdc UTSW 11 121221562 missense probably benign 0.03
R6127:Hexdc UTSW 11 121216999 missense possibly damaging 0.89
R6154:Hexdc UTSW 11 121221271 missense probably benign 0.02
R6921:Hexdc UTSW 11 121222281 missense probably damaging 0.98
R6928:Hexdc UTSW 11 121212054 missense possibly damaging 0.82
R6939:Hexdc UTSW 11 121222338 missense probably benign 0.09
R7125:Hexdc UTSW 11 121204670 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCACTAGACCTGATGAGATGGTTC -3'
(R):5'- AAGGACCTGGGATGATCTGG -3'

Sequencing Primer
(F):5'- CTGGTCTACAAAGTGAGCTCCAG -3'
(R):5'- GGGATTCCATGCCAGGACAG -3'
Posted On2015-04-30