Incidental Mutation 'R0387:Plk4'
ID31326
Institutional Source Beutler Lab
Gene Symbol Plk4
Ensembl Gene ENSMUSG00000025758
Gene Namepolo like kinase 4
SynonymsStk18, Sak
MMRRC Submission 038593-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0387 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location40800019-40816883 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 40812884 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026858] [ENSMUST00000167556] [ENSMUST00000203295] [ENSMUST00000203895] [ENSMUST00000204032]
Predicted Effect probably benign
Transcript: ENSMUST00000026858
SMART Domains Protein: ENSMUSP00000026858
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 774 6e-41 PDB
low complexity region 820 831 N/A INTRINSIC
Pfam:POLO_box 849 910 7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167556
SMART Domains Protein: ENSMUSP00000126945
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 551 771 6e-41 PDB
low complexity region 817 828 N/A INTRINSIC
Pfam:POLO_box 844 908 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203295
SMART Domains Protein: ENSMUSP00000145277
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 747 3e-32 PDB
low complexity region 793 804 N/A INTRINSIC
Pfam:POLO_box 822 883 6.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203895
SMART Domains Protein: ENSMUSP00000145455
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
STYKc 12 143 3.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204032
SMART Domains Protein: ENSMUSP00000145201
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
Pfam:POLO_box 81 142 2.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204594
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: This gene encodes a member of the polo family of serine/threonine protein kinases. The protein localizes to the nucleolus during G2, to centrosomes during G2/M, and to the cleavage furrow during cytokinesis. It is required for progression through mitosis, cell survival, and embryonic development. The mouse genome contains a pseudogene similar to this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for disruptions of this gene die before birth. Development is arrested around E7.5. Mice heterozygous for an ENU-induced allele or gene trap alele exhibit male hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,332,852 probably null Het
Abcc9 T A 6: 142,639,504 K825* probably null Het
Afp T C 5: 90,497,291 C189R probably damaging Het
Akap9 T C 5: 3,951,678 probably benign Het
Alpk3 A T 7: 81,104,227 T1652S possibly damaging Het
Atg4b C A 1: 93,786,556 Q354K probably benign Het
Atxn2 T C 5: 121,802,143 S388P possibly damaging Het
C2cd3 T A 7: 100,422,507 probably benign Het
Cacna2d2 C A 9: 107,513,881 T403K probably damaging Het
Cap2 C T 13: 46,560,516 H79Y probably damaging Het
Car10 G T 11: 93,583,021 probably null Het
Ccno T C 13: 112,989,867 L290P probably damaging Het
Cfap69 T C 5: 5,589,303 K624E probably damaging Het
Ctnna3 A G 10: 64,586,130 M568V probably benign Het
Cyp1b1 C A 17: 79,713,774 V180L probably benign Het
Cyp2u1 G T 3: 131,295,552 probably null Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnm1 C T 2: 32,320,581 G1S possibly damaging Het
Dnmt1 A G 9: 20,918,213 L698P probably damaging Het
Dock10 C A 1: 80,540,276 C1327F probably damaging Het
Dph3b-ps A G 13: 106,546,855 noncoding transcript Het
Dpyd G A 3: 119,427,226 D949N probably benign Het
Dync2li1 A G 17: 84,655,340 K345E possibly damaging Het
Eml2 T A 7: 19,182,259 probably null Het
Exoc7 A G 11: 116,294,401 probably benign Het
Faah A T 4: 116,005,692 C113* probably null Het
Fcf1 T A 12: 84,973,002 D16E probably benign Het
Fcgbp T C 7: 28,091,454 probably benign Het
Ghr A G 15: 3,319,891 S602P probably benign Het
Gm10334 A G 6: 41,443,369 I141T possibly damaging Het
Gm5114 T C 7: 39,408,809 D462G probably benign Het
Gm8186 T A 17: 26,099,026 S66C probably damaging Het
Gorab C T 1: 163,396,834 V133M probably benign Het
Gria1 G A 11: 57,309,884 probably null Het
Grik1 T A 16: 88,034,350 probably benign Het
Gtf3c1 A G 7: 125,681,104 L378P probably damaging Het
Htr5b A T 1: 121,527,546 V215D probably damaging Het
Htra1 A G 7: 130,979,478 T319A probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klrb1a A C 6: 128,609,734 H189Q possibly damaging Het
Lhfp A G 3: 53,043,328 T8A probably benign Het
Ly75 T A 2: 60,306,404 Y1493F probably benign Het
Mfsd5 T C 15: 102,281,096 I301T possibly damaging Het
Mlkl C T 8: 111,333,350 E135K probably damaging Het
Mrgprx2 A C 7: 48,499,160 M1R probably null Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Mtbp A G 15: 55,611,029 I280V possibly damaging Het
Myo5c A T 9: 75,285,021 probably benign Het
Nos3 A G 5: 24,367,585 K174R probably damaging Het
Oas2 A T 5: 120,745,672 probably benign Het
Olfr889 T A 9: 38,115,770 probably null Het
Pi4kb G C 3: 94,984,740 E256Q probably benign Het
Pik3c2a T A 7: 116,373,744 I739F probably damaging Het
Pla2r1 T A 2: 60,432,601 K1031N probably benign Het
Polq T C 16: 37,029,430 C349R probably damaging Het
Polq G T 16: 37,089,317 E2354D probably damaging Het
Prss22 A G 17: 23,993,929 L278P probably damaging Het
Ptprk G A 10: 28,354,629 V239I possibly damaging Het
Raph1 T G 1: 60,510,496 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor3 C T 2: 167,983,772 W755* probably null Het
Rnd3 G T 2: 51,148,231 D77E probably damaging Het
Ryr1 T C 7: 29,083,367 probably benign Het
Serpinb1a C T 13: 32,848,738 V63I probably benign Het
Six1 T G 12: 73,046,041 Y129S probably damaging Het
Spata31d1a G A 13: 59,703,501 T271I probably damaging Het
Stab1 T C 14: 31,148,101 D1387G probably benign Het
Stra6 T A 9: 58,153,183 M625K probably benign Het
Syne1 T C 10: 5,351,029 S900G probably benign Het
Tdpoz4 A C 3: 93,796,700 K101N probably benign Het
Tigd2 T C 6: 59,211,158 Y337H probably benign Het
Tnxb A G 17: 34,683,574 I1134V probably benign Het
Tspyl5 A G 15: 33,686,935 I288T probably damaging Het
Ulk1 A G 5: 110,788,797 V61A possibly damaging Het
Xxylt1 A G 16: 30,957,376 Y381H probably benign Het
Zcchc9 T A 13: 91,800,947 M12L probably benign Het
Zfp106 T C 2: 120,528,472 probably null Het
Zfp74 T A 7: 29,934,754 T510S probably benign Het
Zfp808 A G 13: 62,169,478 T14A probably damaging Het
Other mutations in Plk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Plk4 APN 3 40801789 missense probably damaging 1.00
IGL01730:Plk4 APN 3 40805850 missense probably benign 0.00
IGL01906:Plk4 APN 3 40810381 missense probably null 0.01
IGL02021:Plk4 APN 3 40810708 missense probably damaging 0.97
IGL02718:Plk4 APN 3 40815021 missense probably damaging 1.00
IGL03287:Plk4 APN 3 40805118 missense probably benign 0.11
R0058:Plk4 UTSW 3 40805872 missense probably benign
R0058:Plk4 UTSW 3 40805872 missense probably benign
R0312:Plk4 UTSW 3 40813547 missense probably damaging 0.97
R0411:Plk4 UTSW 3 40811219 unclassified probably benign
R0480:Plk4 UTSW 3 40805640 missense probably benign 0.15
R1170:Plk4 UTSW 3 40801847 missense probably damaging 1.00
R1268:Plk4 UTSW 3 40811369 missense probably damaging 1.00
R1529:Plk4 UTSW 3 40806536 missense probably benign 0.09
R1987:Plk4 UTSW 3 40805817 missense possibly damaging 0.60
R1988:Plk4 UTSW 3 40805817 missense possibly damaging 0.60
R2050:Plk4 UTSW 3 40810380 missense probably benign
R4409:Plk4 UTSW 3 40806549 missense probably damaging 0.98
R4727:Plk4 UTSW 3 40805154 missense probably benign 0.00
R4765:Plk4 UTSW 3 40802022 missense probably damaging 1.00
R4772:Plk4 UTSW 3 40805190 missense probably damaging 1.00
R5022:Plk4 UTSW 3 40802077 splice site probably null
R5363:Plk4 UTSW 3 40801984 missense possibly damaging 0.71
R5651:Plk4 UTSW 3 40813505 missense probably benign 0.00
R5665:Plk4 UTSW 3 40813586 missense possibly damaging 0.79
R5724:Plk4 UTSW 3 40801046 missense probably damaging 1.00
R6391:Plk4 UTSW 3 40808973 missense probably benign 0.05
R6694:Plk4 UTSW 3 40801828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGTAGCCAAGCCTCGTAGCCC -3'
(R):5'- TCAGGCAGACATATGGCAAAGTAGC -3'

Sequencing Primer
(F):5'- CATTGACAAGCTTTAGGGGACATC -3'
(R):5'- CATATGGCAAAGTAGCTGAGTG -3'
Posted On2013-04-24