Incidental Mutation 'R4022:Mast4'
ID313315
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Namemicrotubule associated serine/threonine kinase family member 4
Synonyms4930420O11Rik
MMRRC Submission 040956-MU
Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791ENSMUST00000091273

Is this an essential gene? Possibly essential (E-score: 0.538) question?
Stock #R4022 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location102732486-103334497 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 102739321 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1112 (R1112*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]
Predicted Effect probably null
Transcript: ENSMUST00000099202
AA Change: R1103*
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: R1103*

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166726
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167058
AA Change: R1280*
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: R1280*

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167462
SMART Domains Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 3e-145 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 843 878 N/A INTRINSIC
PDZ 888 968 2.34e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000171791
AA Change: R1088*
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: R1088*

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Predicted Effect probably null
Transcript: ENSMUST00000194446
AA Change: R1112*
Meta Mutation Damage Score 0.68 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abo T A 2: 26,843,800 Y131F probably damaging Het
Adcy4 C T 14: 55,775,178 probably null Het
Ago3 T A 4: 126,368,593 N388I probably benign Het
Arfgef2 G T 2: 166,873,945 V1385L probably benign Het
Camk2a A T 18: 60,963,928 K28* probably null Het
Ccdc180 T A 4: 45,904,560 Y385* probably null Het
Cd209g A T 8: 4,135,955 Q46L possibly damaging Het
Cdh22 T C 2: 165,157,253 T220A probably benign Het
Cltc A T 11: 86,720,348 C562S probably damaging Het
Cyp2c55 T A 19: 39,035,434 probably null Het
Cyp2d34 A G 15: 82,618,608 V139A probably benign Het
D17Wsu92e T C 17: 27,786,262 E107G probably damaging Het
Ddias G T 7: 92,861,478 D105E possibly damaging Het
Dhx30 T C 9: 110,084,397 D1223G possibly damaging Het
Dnajb11 A G 16: 22,869,446 D238G probably damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Erbb2 T G 11: 98,435,297 C966W probably benign Het
Exoc1 C T 5: 76,549,570 T405I possibly damaging Het
Fbxo28 T C 1: 182,329,910 N108S possibly damaging Het
Fhdc1 T C 3: 84,445,102 E157G probably benign Het
Gstcd C T 3: 133,082,068 V290M probably damaging Het
Hps3 A G 3: 20,035,261 V2A possibly damaging Het
Itsn2 G A 12: 4,624,927 R23H probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lax1 C T 1: 133,683,036 G105S probably benign Het
Lin7c G T 2: 109,896,445 probably null Het
Lrrn2 T C 1: 132,939,114 V639A probably benign Het
Luzp1 T C 4: 136,542,193 S576P probably benign Het
Mat2a G A 6: 72,436,244 R168C probably damaging Het
Megf8 T C 7: 25,337,775 V700A probably damaging Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Myh2 G T 11: 67,179,404 E421* probably null Het
Olfr102 T A 17: 37,314,274 I37L probably benign Het
Olfr181 T C 16: 58,926,120 I150M possibly damaging Het
Pecam1 T C 11: 106,655,160 N693D probably benign Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prune2 A G 19: 17,000,020 T40A probably damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Reln T C 5: 22,227,630 Q124R probably benign Het
Rnf17 C T 14: 56,460,001 H451Y probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Sall3 T A 18: 80,969,840 E1127V probably benign Het
Sertad3 A G 7: 27,476,695 N185D probably damaging Het
Sox1 A G 8: 12,396,719 Y120C probably damaging Het
Spag17 A T 3: 100,049,230 I881F probably benign Het
Spg20 G T 3: 55,117,736 V251L probably damaging Het
Stard9 A G 2: 120,704,155 E3631G probably benign Het
Syde2 A G 3: 146,015,725 T848A probably benign Het
Tmem11 T C 11: 60,865,328 D12G possibly damaging Het
Trim28 T C 7: 13,028,558 probably benign Het
Tsen2 T A 6: 115,547,987 V49E probably damaging Het
Tspan1 C T 4: 116,167,035 M10I probably benign Het
Uncx A T 5: 139,546,689 T170S probably damaging Het
Usp24 T C 4: 106,379,224 probably benign Het
Vmn1r84 T C 7: 12,361,930 I267V probably benign Het
Zfp488 T A 14: 33,971,153 M18L probably benign Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102770767 nonsense probably null
IGL00933:Mast4 APN 13 102735366 missense probably damaging 0.97
IGL01113:Mast4 APN 13 102774236 missense probably damaging 1.00
IGL01461:Mast4 APN 13 102754068 missense probably damaging 1.00
IGL01569:Mast4 APN 13 102761015 missense probably damaging 1.00
IGL01697:Mast4 APN 13 102767893 missense probably damaging 1.00
IGL01725:Mast4 APN 13 102750512 critical splice donor site probably null
IGL01734:Mast4 APN 13 102737615 missense probably damaging 0.98
IGL01738:Mast4 APN 13 102737241 missense probably damaging 1.00
IGL01739:Mast4 APN 13 102774273 missense probably damaging 1.00
IGL02299:Mast4 APN 13 102737974 missense probably benign 0.44
IGL02479:Mast4 APN 13 102742037 missense probably damaging 1.00
IGL02485:Mast4 APN 13 102735496 missense probably benign 0.02
IGL02528:Mast4 APN 13 102853823 makesense probably null
IGL02850:Mast4 APN 13 102754232 missense probably damaging 1.00
IGL02900:Mast4 APN 13 102735676 missense probably benign
IGL03064:Mast4 APN 13 102760964 nonsense probably null
IGL03124:Mast4 APN 13 102738245 missense probably damaging 1.00
IGL03146:Mast4 APN 13 102737655 missense probably benign 0.00
IGL03221:Mast4 APN 13 102754256 missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102751397 missense probably damaging 1.00
IGL03406:Mast4 APN 13 102737107 missense possibly damaging 0.46
buck UTSW 13 102761293 critical splice donor site probably null
doe UTSW 13 102905677 missense possibly damaging 0.85
FR4304:Mast4 UTSW 13 102734862 utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102734857 frame shift probably null
FR4340:Mast4 UTSW 13 102736317 small insertion probably benign
FR4548:Mast4 UTSW 13 102736318 small insertion probably benign
FR4976:Mast4 UTSW 13 102736312 small insertion probably benign
FR4976:Mast4 UTSW 13 102739247 frame shift probably null
NA:Mast4 UTSW 13 102742057 missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
R0009:Mast4 UTSW 13 102742058 missense probably damaging 1.00
R0063:Mast4 UTSW 13 103334215 start gained probably benign
R0242:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R0310:Mast4 UTSW 13 102754161 missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102735273 missense probably damaging 1.00
R0454:Mast4 UTSW 13 102751560 missense probably damaging 1.00
R0646:Mast4 UTSW 13 102758744 splice site probably benign
R0744:Mast4 UTSW 13 102737387 missense probably damaging 0.98
R0883:Mast4 UTSW 13 102853900 missense probably damaging 1.00
R0905:Mast4 UTSW 13 102770784 missense probably damaging 0.99
R1023:Mast4 UTSW 13 102735496 missense probably benign 0.02
R1281:Mast4 UTSW 13 102750578 missense probably damaging 1.00
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102772519 missense probably damaging 1.00
R1572:Mast4 UTSW 13 102736923 missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102739263 missense probably damaging 1.00
R1865:Mast4 UTSW 13 102794117 missense probably damaging 1.00
R2050:Mast4 UTSW 13 102751409 missense probably damaging 1.00
R2060:Mast4 UTSW 13 102738846 missense probably damaging 1.00
R2062:Mast4 UTSW 13 102759093 missense probably benign 0.18
R2106:Mast4 UTSW 13 102750546 missense probably damaging 1.00
R2118:Mast4 UTSW 13 102754205 missense probably damaging 1.00
R2143:Mast4 UTSW 13 102735475 missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102735751 missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102798207 splice site probably benign
R2370:Mast4 UTSW 13 102774187 missense probably damaging 1.00
R2504:Mast4 UTSW 13 102738639 missense probably damaging 0.96
R2509:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R2842:Mast4 UTSW 13 102736431 missense probably benign 0.01
R3087:Mast4 UTSW 13 102853926 splice site probably benign
R3434:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3435:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3763:Mast4 UTSW 13 102787419 missense probably damaging 1.00
R3826:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3829:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3830:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3913:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R3914:Mast4 UTSW 13 102739321 nonsense probably null
R4021:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102853869 missense probably damaging 1.00
R4210:Mast4 UTSW 13 102739205 missense probably damaging 1.00
R4342:Mast4 UTSW 13 102774248 missense probably damaging 1.00
R4580:Mast4 UTSW 13 102737258 nonsense probably null
R4627:Mast4 UTSW 13 103334021 missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103334119 missense probably benign 0.01
R4732:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4733:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4833:Mast4 UTSW 13 102774184 critical splice donor site probably null
R4995:Mast4 UTSW 13 102905754 intron probably benign
R5059:Mast4 UTSW 13 102750563 missense probably damaging 1.00
R5073:Mast4 UTSW 13 102738883 nonsense probably null
R5101:Mast4 UTSW 13 102736356 missense probably benign 0.01
R5526:Mast4 UTSW 13 102754215 missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102737479 missense probably damaging 1.00
R5673:Mast4 UTSW 13 102794072 missense probably damaging 1.00
R5694:Mast4 UTSW 13 102774193 nonsense probably null
R5906:Mast4 UTSW 13 102735744 missense probably benign 0.31
R5908:Mast4 UTSW 13 102738256 missense probably damaging 1.00
R5947:Mast4 UTSW 13 102735640 missense probably benign
R5987:Mast4 UTSW 13 102758734 missense probably damaging 1.00
R6143:Mast4 UTSW 13 102853883 missense probably damaging 1.00
R6154:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6169:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6239:Mast4 UTSW 13 102736209 missense probably benign 0.01
R6327:Mast4 UTSW 13 102761382 missense probably damaging 1.00
R6356:Mast4 UTSW 13 102735985 missense possibly damaging 0.80
R6432:Mast4 UTSW 13 102905677 missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102761293 critical splice donor site probably null
R6667:Mast4 UTSW 13 102737496 missense probably damaging 1.00
R6941:Mast4 UTSW 13 102804714 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102798078 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6970:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6980:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6991:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6992:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6993:Mast4 UTSW 13 102735974 missense probably benign 0.28
R6993:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R7083:Mast4 UTSW 13 102737715 missense probably damaging 1.00
R7241:Mast4 UTSW 13 103334000 missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102738478 missense probably damaging 1.00
R7246:Mast4 UTSW 13 102794003 missense probably damaging 1.00
Z1088:Mast4 UTSW 13 102738519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGTCATGTGTGATTCAGCC -3'
(R):5'- CACAGAAGTGGCATGCTACC -3'

Sequencing Primer
(F):5'- GTGATTCAGCCTGTTTTCCTAAG -3'
(R):5'- TACCATTTAGCAGGTCGGC -3'
Posted On2015-04-30